ID: 952560147

View in Genome Browser
Species Human (GRCh38)
Location 3:34582796-34582818
Sequence AATCTTTTTGCCACTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952560147_952560151 0 Left 952560147 3:34582796-34582818 CCAGTTATAGTGGCAAAAAGATT No data
Right 952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG No data
952560147_952560149 -6 Left 952560147 3:34582796-34582818 CCAGTTATAGTGGCAAAAAGATT No data
Right 952560149 3:34582813-34582835 AAGATTCCTCGAAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952560147 Original CRISPR AATCTTTTTGCCACTATAAC TGG (reversed) Intergenic
No off target data available for this crispr