ID: 952560151

View in Genome Browser
Species Human (GRCh38)
Location 3:34582819-34582841
Sequence CCTCGAAGGCAGAGAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952560147_952560151 0 Left 952560147 3:34582796-34582818 CCAGTTATAGTGGCAAAAAGATT No data
Right 952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG No data
952560145_952560151 10 Left 952560145 3:34582786-34582808 CCAGCAAAGTCCAGTTATAGTGG No data
Right 952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952560151 Original CRISPR CCTCGAAGGCAGAGAGGCCA TGG Intergenic
No off target data available for this crispr