ID: 952563062

View in Genome Browser
Species Human (GRCh38)
Location 3:34618509-34618531
Sequence ATAGAGAAGCTGAATGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952563062_952563063 -10 Left 952563062 3:34618509-34618531 CCTTATTCATTCAGCTTCTCTAT No data
Right 952563063 3:34618522-34618544 GCTTCTCTATAGCTTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952563062 Original CRISPR ATAGAGAAGCTGAATGAATA AGG (reversed) Intergenic
No off target data available for this crispr