ID: 952568925

View in Genome Browser
Species Human (GRCh38)
Location 3:34690289-34690311
Sequence TGAATTAGGACCCACCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952568925_952568929 25 Left 952568925 3:34690289-34690311 CCCATTAGGTGGGTCCTAATTCA No data
Right 952568929 3:34690337-34690359 ATTAAGATACAGATACAGCGAGG No data
952568925_952568930 26 Left 952568925 3:34690289-34690311 CCCATTAGGTGGGTCCTAATTCA No data
Right 952568930 3:34690338-34690360 TTAAGATACAGATACAGCGAGGG No data
952568925_952568928 0 Left 952568925 3:34690289-34690311 CCCATTAGGTGGGTCCTAATTCA No data
Right 952568928 3:34690312-34690334 ATATGACTTGCATCTTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952568925 Original CRISPR TGAATTAGGACCCACCTAAT GGG (reversed) Intergenic
No off target data available for this crispr