ID: 952570356

View in Genome Browser
Species Human (GRCh38)
Location 3:34708675-34708697
Sequence GAGTCAAATGTGGATCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952570356_952570364 6 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570364 3:34708704-34708726 GAATGAGAAATAAATGGAGGGGG No data
952570356_952570363 5 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570363 3:34708703-34708725 TGAATGAGAAATAAATGGAGGGG No data
952570356_952570360 0 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570360 3:34708698-34708720 AAATGTGAATGAGAAATAAATGG No data
952570356_952570365 7 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570365 3:34708705-34708727 AATGAGAAATAAATGGAGGGGGG No data
952570356_952570361 3 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570361 3:34708701-34708723 TGTGAATGAGAAATAAATGGAGG No data
952570356_952570362 4 Left 952570356 3:34708675-34708697 CCCCACTGATCCACATTTGACTC No data
Right 952570362 3:34708702-34708724 GTGAATGAGAAATAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952570356 Original CRISPR GAGTCAAATGTGGATCAGTG GGG (reversed) Intergenic
No off target data available for this crispr