ID: 952572270

View in Genome Browser
Species Human (GRCh38)
Location 3:34731753-34731775
Sequence AAGAAAACTGAGCTCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952572264_952572270 5 Left 952572264 3:34731725-34731747 CCATCATCACTGTGGCTGCCTGT No data
Right 952572270 3:34731753-34731775 AAGAAAACTGAGCTCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952572270 Original CRISPR AAGAAAACTGAGCTCCCTGG GGG Intergenic