ID: 952575356

View in Genome Browser
Species Human (GRCh38)
Location 3:34767929-34767951
Sequence CAGGTTTATCAAAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952575356_952575363 1 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575363 3:34767953-34767975 CAGAAACAAGAAATGGGGAAAGG 0: 51
1: 3484
2: 6489
3: 9787
4: 5360
952575356_952575359 -6 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575359 3:34767946-34767968 AACCTGACAGAAACAAGAAATGG 0: 54
1: 3939
2: 6797
3: 9417
4: 3596
952575356_952575362 -4 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575362 3:34767948-34767970 CCTGACAGAAACAAGAAATGGGG 0: 48
1: 3795
2: 6598
3: 9476
4: 3612
952575356_952575364 21 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575364 3:34767973-34767995 AGGATTCCCTATTTAATAAATGG 0: 12666
1: 6533
2: 3352
3: 2822
4: 3159
952575356_952575360 -5 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575360 3:34767947-34767969 ACCTGACAGAAACAAGAAATGGG 0: 51
1: 3880
2: 6782
3: 9445
4: 3536
952575356_952575366 27 Left 952575356 3:34767929-34767951 CCATCTGCCCTTTGATAAACCTG No data
Right 952575366 3:34767979-34768001 CCCTATTTAATAAATGGTGCTGG 0: 11855
1: 7681
2: 5612
3: 4743
4: 4663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952575356 Original CRISPR CAGGTTTATCAAAGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr