ID: 952580671

View in Genome Browser
Species Human (GRCh38)
Location 3:34830011-34830033
Sequence CCCAATATGTAGTAGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952580671_952580675 29 Left 952580671 3:34830011-34830033 CCAGGGCTCTACTACATATTGGG No data
Right 952580675 3:34830063-34830085 CAAGTTCTGCTGATGGGTGATGG No data
952580671_952580673 22 Left 952580671 3:34830011-34830033 CCAGGGCTCTACTACATATTGGG No data
Right 952580673 3:34830056-34830078 TCAGATGCAAGTTCTGCTGATGG No data
952580671_952580674 23 Left 952580671 3:34830011-34830033 CCAGGGCTCTACTACATATTGGG No data
Right 952580674 3:34830057-34830079 CAGATGCAAGTTCTGCTGATGGG No data
952580671_952580676 30 Left 952580671 3:34830011-34830033 CCAGGGCTCTACTACATATTGGG No data
Right 952580676 3:34830064-34830086 AAGTTCTGCTGATGGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952580671 Original CRISPR CCCAATATGTAGTAGAGCCC TGG (reversed) Intergenic
No off target data available for this crispr