ID: 952588356

View in Genome Browser
Species Human (GRCh38)
Location 3:34920506-34920528
Sequence ATTAAGAAGGAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952588356_952588358 29 Left 952588356 3:34920506-34920528 CCATTCTCATTCTCCTTCTTAAT No data
Right 952588358 3:34920558-34920580 ACATTTTAATTTACTTATAATGG No data
952588356_952588359 30 Left 952588356 3:34920506-34920528 CCATTCTCATTCTCCTTCTTAAT No data
Right 952588359 3:34920559-34920581 CATTTTAATTTACTTATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952588356 Original CRISPR ATTAAGAAGGAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr