ID: 952591065

View in Genome Browser
Species Human (GRCh38)
Location 3:34954253-34954275
Sequence CTGTGTATGGGGAAGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952591059_952591065 14 Left 952591059 3:34954216-34954238 CCTGAAATAGTAAAGCCACACTA No data
Right 952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG No data
952591060_952591065 -1 Left 952591060 3:34954231-34954253 CCACACTAATACAGACAATAAGC No data
Right 952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952591065 Original CRISPR CTGTGTATGGGGAAGGAGAT AGG Intergenic
No off target data available for this crispr