ID: 952594309

View in Genome Browser
Species Human (GRCh38)
Location 3:34997420-34997442
Sequence GGGTGGAAATAGATGTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952594303_952594309 20 Left 952594303 3:34997377-34997399 CCATTGGAGTTAGTGGTAGCCAT No data
Right 952594309 3:34997420-34997442 GGGTGGAAATAGATGTAATATGG No data
952594304_952594309 1 Left 952594304 3:34997396-34997418 CCATGCGCTAAGCTCCAAACAAT No data
Right 952594309 3:34997420-34997442 GGGTGGAAATAGATGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952594309 Original CRISPR GGGTGGAAATAGATGTAATA TGG Intergenic
No off target data available for this crispr