ID: 952594413

View in Genome Browser
Species Human (GRCh38)
Location 3:34998773-34998795
Sequence ATTTACATGCAGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952594413_952594419 24 Left 952594413 3:34998773-34998795 CCTTCCATCTTCTGCATGTAAAT No data
Right 952594419 3:34998820-34998842 AATATAAAATAAATGTGATGAGG No data
952594413_952594415 -8 Left 952594413 3:34998773-34998795 CCTTCCATCTTCTGCATGTAAAT No data
Right 952594415 3:34998788-34998810 ATGTAAATACCAATTCAAATTGG No data
952594413_952594416 -7 Left 952594413 3:34998773-34998795 CCTTCCATCTTCTGCATGTAAAT No data
Right 952594416 3:34998789-34998811 TGTAAATACCAATTCAAATTGGG No data
952594413_952594417 -2 Left 952594413 3:34998773-34998795 CCTTCCATCTTCTGCATGTAAAT No data
Right 952594417 3:34998794-34998816 ATACCAATTCAAATTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952594413 Original CRISPR ATTTACATGCAGAAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr