ID: 952598471

View in Genome Browser
Species Human (GRCh38)
Location 3:35048512-35048534
Sequence ACTGGGGTTTTGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952598471_952598478 -3 Left 952598471 3:35048512-35048534 CCAGCTTCCCTCAAAACCCCAGT No data
Right 952598478 3:35048532-35048554 AGTATTCATCAAAAATCCCAGGG No data
952598471_952598477 -4 Left 952598471 3:35048512-35048534 CCAGCTTCCCTCAAAACCCCAGT No data
Right 952598477 3:35048531-35048553 CAGTATTCATCAAAAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952598471 Original CRISPR ACTGGGGTTTTGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr