ID: 952599823

View in Genome Browser
Species Human (GRCh38)
Location 3:35066714-35066736
Sequence GCAAATTTTCAGATTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952599821_952599823 15 Left 952599821 3:35066676-35066698 CCAGCATCATTAACATCAACTAG No data
Right 952599823 3:35066714-35066736 GCAAATTTTCAGATTGAAGCTGG No data
952599819_952599823 21 Left 952599819 3:35066670-35066692 CCCAGACCAGCATCATTAACATC No data
Right 952599823 3:35066714-35066736 GCAAATTTTCAGATTGAAGCTGG No data
952599820_952599823 20 Left 952599820 3:35066671-35066693 CCAGACCAGCATCATTAACATCA No data
Right 952599823 3:35066714-35066736 GCAAATTTTCAGATTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952599823 Original CRISPR GCAAATTTTCAGATTGAAGC TGG Intergenic
No off target data available for this crispr