ID: 952610110

View in Genome Browser
Species Human (GRCh38)
Location 3:35198626-35198648
Sequence CTCTAGGATATTTCATTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952610110_952610113 -7 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610113 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
952610110_952610118 27 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG No data
952610110_952610119 28 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610119 3:35198677-35198699 TCTATGACAAGAAGCTGGGTGGG No data
952610110_952610116 24 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610116 3:35198673-35198695 AACCTCTATGACAAGAAGCTGGG No data
952610110_952610114 0 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610114 3:35198649-35198671 CTGCTGCTGTAATGGGTACAAGG No data
952610110_952610115 23 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610115 3:35198672-35198694 TAACCTCTATGACAAGAAGCTGG No data
952610110_952610111 -8 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610111 3:35198641-35198663 TCCTAGAGCTGCTGCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952610110 Original CRISPR CTCTAGGATATTTCATTCTG TGG (reversed) Intergenic
No off target data available for this crispr