ID: 952610112

View in Genome Browser
Species Human (GRCh38)
Location 3:35198642-35198664
Sequence CCCATTACAGCAGCAGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952610112_952610115 7 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610115 3:35198672-35198694 TAACCTCTATGACAAGAAGCTGG No data
952610112_952610118 11 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG No data
952610112_952610121 22 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610121 3:35198687-35198709 GAAGCTGGGTGGGATGTGAAGGG No data
952610112_952610116 8 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610116 3:35198673-35198695 AACCTCTATGACAAGAAGCTGGG No data
952610112_952610122 23 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610122 3:35198688-35198710 AAGCTGGGTGGGATGTGAAGGGG No data
952610112_952610123 24 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610123 3:35198689-35198711 AGCTGGGTGGGATGTGAAGGGGG No data
952610112_952610119 12 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610119 3:35198677-35198699 TCTATGACAAGAAGCTGGGTGGG No data
952610112_952610120 21 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610120 3:35198686-35198708 AGAAGCTGGGTGGGATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952610112 Original CRISPR CCCATTACAGCAGCAGCTCT AGG (reversed) Intergenic
No off target data available for this crispr