ID: 952610118

View in Genome Browser
Species Human (GRCh38)
Location 3:35198676-35198698
Sequence CTCTATGACAAGAAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952610112_952610118 11 Left 952610112 3:35198642-35198664 CCTAGAGCTGCTGCTGTAATGGG No data
Right 952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG No data
952610110_952610118 27 Left 952610110 3:35198626-35198648 CCACAGAATGAAATATCCTAGAG No data
Right 952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952610118 Original CRISPR CTCTATGACAAGAAGCTGGG TGG Intergenic
No off target data available for this crispr