ID: 952611544

View in Genome Browser
Species Human (GRCh38)
Location 3:35216086-35216108
Sequence CAGCTCGGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952611533_952611544 12 Left 952611533 3:35216051-35216073 CCCATGTCCTGCTTGGCCCGCTG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data
952611537_952611544 5 Left 952611537 3:35216058-35216080 CCTGCTTGGCCCGCTGCAGGGCG 0: 8
1: 13
2: 16
3: 28
4: 136
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data
952611532_952611544 13 Left 952611532 3:35216050-35216072 CCCCATGTCCTGCTTGGCCCGCT 0: 1
1: 0
2: 1
3: 18
4: 129
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data
952611534_952611544 11 Left 952611534 3:35216052-35216074 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data
952611539_952611544 -4 Left 952611539 3:35216067-35216089 CCCGCTGCAGGGCGGCTTCCAGC No data
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data
952611540_952611544 -5 Left 952611540 3:35216068-35216090 CCGCTGCAGGGCGGCTTCCAGCT No data
Right 952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952611544 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG Intergenic
No off target data available for this crispr