ID: 952619470

View in Genome Browser
Species Human (GRCh38)
Location 3:35320020-35320042
Sequence GCCCCTATCAAAATAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952619467_952619470 2 Left 952619467 3:35319995-35320017 CCCATTGACCAGGGTGGTGTTTC No data
Right 952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG No data
952619468_952619470 1 Left 952619468 3:35319996-35320018 CCATTGACCAGGGTGGTGTTTCA No data
Right 952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG No data
952619463_952619470 12 Left 952619463 3:35319985-35320007 CCATTTATATCCCATTGACCAGG No data
Right 952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG No data
952619462_952619470 25 Left 952619462 3:35319972-35319994 CCTCACAACACTTCCATTTATAT No data
Right 952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG No data
952619469_952619470 -6 Left 952619469 3:35320003-35320025 CCAGGGTGGTGTTTCATGCCCCT No data
Right 952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952619470 Original CRISPR GCCCCTATCAAAATAATCTC TGG Intergenic
No off target data available for this crispr