ID: 952626743

View in Genome Browser
Species Human (GRCh38)
Location 3:35415034-35415056
Sequence ATCTACTAGCAAAAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952626743_952626750 8 Left 952626743 3:35415034-35415056 CCCACCAGCTTTTGCTAGTAGAT No data
Right 952626750 3:35415065-35415087 GTGCTTAGCTGATAATTGCAGGG No data
952626743_952626749 7 Left 952626743 3:35415034-35415056 CCCACCAGCTTTTGCTAGTAGAT No data
Right 952626749 3:35415064-35415086 GGTGCTTAGCTGATAATTGCAGG No data
952626743_952626751 17 Left 952626743 3:35415034-35415056 CCCACCAGCTTTTGCTAGTAGAT No data
Right 952626751 3:35415074-35415096 TGATAATTGCAGGGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952626743 Original CRISPR ATCTACTAGCAAAAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr