ID: 952628356

View in Genome Browser
Species Human (GRCh38)
Location 3:35435087-35435109
Sequence GGGTTAATACAAATAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952628355_952628356 -6 Left 952628355 3:35435070-35435092 CCTTCTTAATGAAGATGGGGTTA No data
Right 952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG No data
952628350_952628356 12 Left 952628350 3:35435052-35435074 CCAAGAGAAGCAGATTGCCCTTC No data
Right 952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG No data
952628354_952628356 -5 Left 952628354 3:35435069-35435091 CCCTTCTTAATGAAGATGGGGTT No data
Right 952628356 3:35435087-35435109 GGGTTAATACAAATAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952628356 Original CRISPR GGGTTAATACAAATAGTTGA AGG Intergenic
No off target data available for this crispr