ID: 952633034 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:35493013-35493035 |
| Sequence | GATGACGTGACTGCAGCTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952633034_952633037 | 28 | Left | 952633034 | 3:35493013-35493035 | CCAGCAGCTGCAGTCACGTCATC | No data | ||
| Right | 952633037 | 3:35493064-35493086 | TGCATGCACCTGTTGTTAAAGGG | 0: 1 1: 0 2: 0 3: 11 4: 147 |
||||
| 952633034_952633036 | 27 | Left | 952633034 | 3:35493013-35493035 | CCAGCAGCTGCAGTCACGTCATC | No data | ||
| Right | 952633036 | 3:35493063-35493085 | TTGCATGCACCTGTTGTTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952633034 | Original CRISPR | GATGACGTGACTGCAGCTGC TGG (reversed) | Intergenic | ||