ID: 952633036

View in Genome Browser
Species Human (GRCh38)
Location 3:35493063-35493085
Sequence TTGCATGCACCTGTTGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952633034_952633036 27 Left 952633034 3:35493013-35493035 CCAGCAGCTGCAGTCACGTCATC No data
Right 952633036 3:35493063-35493085 TTGCATGCACCTGTTGTTAAAGG No data
952633035_952633036 -10 Left 952633035 3:35493050-35493072 CCATCTCTCAGTTTTGCATGCAC No data
Right 952633036 3:35493063-35493085 TTGCATGCACCTGTTGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952633036 Original CRISPR TTGCATGCACCTGTTGTTAA AGG Intergenic