ID: 952633037

View in Genome Browser
Species Human (GRCh38)
Location 3:35493064-35493086
Sequence TGCATGCACCTGTTGTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952633035_952633037 -9 Left 952633035 3:35493050-35493072 CCATCTCTCAGTTTTGCATGCAC No data
Right 952633037 3:35493064-35493086 TGCATGCACCTGTTGTTAAAGGG No data
952633034_952633037 28 Left 952633034 3:35493013-35493035 CCAGCAGCTGCAGTCACGTCATC No data
Right 952633037 3:35493064-35493086 TGCATGCACCTGTTGTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952633037 Original CRISPR TGCATGCACCTGTTGTTAAA GGG Intergenic