ID: 952636349

View in Genome Browser
Species Human (GRCh38)
Location 3:35537360-35537382
Sequence GTTGTCAGTGGACTGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952636345_952636349 0 Left 952636345 3:35537337-35537359 CCAAAAGCCAGCACCTATGACTC No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636344_952636349 1 Left 952636344 3:35537336-35537358 CCCAAAAGCCAGCACCTATGACT No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636340_952636349 26 Left 952636340 3:35537311-35537333 CCTCCAGGTTGGTTGTGCTTTCC No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636342_952636349 5 Left 952636342 3:35537332-35537354 CCCTCCCAAAAGCCAGCACCTAT No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636346_952636349 -7 Left 952636346 3:35537344-35537366 CCAGCACCTATGACTCGTTGTCA No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636343_952636349 4 Left 952636343 3:35537333-35537355 CCTCCCAAAAGCCAGCACCTATG No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data
952636341_952636349 23 Left 952636341 3:35537314-35537336 CCAGGTTGGTTGTGCTTTCCCTC No data
Right 952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952636349 Original CRISPR GTTGTCAGTGGACTGCCATC AGG Intergenic
No off target data available for this crispr