ID: 952636984

View in Genome Browser
Species Human (GRCh38)
Location 3:35544841-35544863
Sequence TTGGCCAGTAAGGTTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952636981_952636984 5 Left 952636981 3:35544813-35544835 CCTCATTGATTGGCTTCATAATC No data
Right 952636984 3:35544841-35544863 TTGGCCAGTAAGGTTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952636984 Original CRISPR TTGGCCAGTAAGGTTGTTGC AGG Intergenic
No off target data available for this crispr