ID: 952639077

View in Genome Browser
Species Human (GRCh38)
Location 3:35569568-35569590
Sequence ATTGGCTTCTGCCCTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952639077_952639084 28 Left 952639077 3:35569568-35569590 CCAGTACCAGGGCAGAAGCCAAT No data
Right 952639084 3:35569619-35569641 CCCCTATTCCTGAGATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952639077 Original CRISPR ATTGGCTTCTGCCCTGGTAC TGG (reversed) Intergenic
No off target data available for this crispr