ID: 952639799

View in Genome Browser
Species Human (GRCh38)
Location 3:35579785-35579807
Sequence GGATCCTTAGTTCTAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952639794_952639799 10 Left 952639794 3:35579752-35579774 CCACAGGGGAATAGAGCACAAAG No data
Right 952639799 3:35579785-35579807 GGATCCTTAGTTCTAGAACTTGG No data
952639793_952639799 19 Left 952639793 3:35579743-35579765 CCAGCTTAGCCACAGGGGAATAG No data
Right 952639799 3:35579785-35579807 GGATCCTTAGTTCTAGAACTTGG No data
952639789_952639799 28 Left 952639789 3:35579734-35579756 CCTTAGATACCAGCTTAGCCACA No data
Right 952639799 3:35579785-35579807 GGATCCTTAGTTCTAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952639799 Original CRISPR GGATCCTTAGTTCTAGAACT TGG Intergenic
No off target data available for this crispr