ID: 952643503

View in Genome Browser
Species Human (GRCh38)
Location 3:35626741-35626763
Sequence AATATCAATGAGGATATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952643503_952643509 20 Left 952643503 3:35626741-35626763 CCATTTATATCCTCATTGATATT No data
Right 952643509 3:35626784-35626806 CACTCAGGACCTTTTGTTCCTGG No data
952643503_952643506 5 Left 952643503 3:35626741-35626763 CCATTTATATCCTCATTGATATT No data
Right 952643506 3:35626769-35626791 CAAATAGCTTCCATCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952643503 Original CRISPR AATATCAATGAGGATATAAA TGG (reversed) Intergenic
No off target data available for this crispr