ID: 952644384

View in Genome Browser
Species Human (GRCh38)
Location 3:35638875-35638897
Sequence CTCCAAGAGCGCTGAGGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952644384 Original CRISPR CTCCAAGAGCGCTGAGGCTA CGG Intergenic
900982427 1:6053822-6053844 CTCCTAAAGTGCTGAGACTACGG - Intronic
902563500 1:17294513-17294535 CTCCCAAAGCGCTGAGATTAAGG - Intergenic
902708695 1:18224033-18224055 CTCCAGCAGGGCTGAGACTAGGG + Intronic
902754939 1:18542725-18542747 CTGCAGGAGAGCTGAGGCTGGGG + Intergenic
906147019 1:43566181-43566203 CGCCTAGAGCGCTGGGGCTGGGG + Intronic
906418189 1:45639467-45639489 CTCCCAGAGCGCTGAGATTATGG - Intronic
906803586 1:48758790-48758812 GACCAAGTGCCCTGAGGCTAGGG - Intronic
910395681 1:86791451-86791473 CTCCAAAAGTGCTGGGACTATGG - Intergenic
911822951 1:102442979-102443001 CTCCAACAGACCTGAAGCTAAGG + Intergenic
912209537 1:107543395-107543417 CTCCCAAAGTGCTGAGACTACGG - Intergenic
914409318 1:147410242-147410264 CCCCAAAAGCTCAGAGGCTAGGG - Intergenic
915182207 1:154071891-154071913 CTCCCAAAGCGCTGAGATTACGG + Intronic
916713534 1:167432197-167432219 CTCACAGAGGGCTGAGGCCAAGG - Intronic
919540827 1:198843319-198843341 CCCCAAGAACTCAGAGGCTAGGG + Intergenic
920219309 1:204384870-204384892 CTCCAGAAGGGCTGAGGTTAGGG + Intergenic
920850409 1:209624469-209624491 CTCCAAGAGCTCAGTGGCCAAGG - Intronic
922524018 1:226283688-226283710 CTCCCAGAGTGCTGAGATTATGG - Intronic
922582927 1:226712008-226712030 CTCCCGGAGCTCTGAGGCCAGGG - Intronic
922701578 1:227764236-227764258 CTCCACGAGCACTGTGGCTCTGG + Intronic
1063390499 10:5647214-5647236 CTCCCAAAGTGCTGAGACTATGG + Intronic
1066700395 10:38121507-38121529 CACCAAGAGGGCTGAGGGTGAGG + Exonic
1066991296 10:42516708-42516730 CACCAAGAGGGCTGAGGGTGAGG - Intergenic
1068033541 10:51732180-51732202 CTCCCAGAGTGCTGGGTCTACGG + Intronic
1069049684 10:63779539-63779561 CTCCAAAGGCGCTGGGGCAAAGG - Intergenic
1069561458 10:69433401-69433423 CTCCAAGACAGCTGAGACCAAGG - Intergenic
1069837229 10:71317098-71317120 CTTCCAGAGCTCTGAGGCTGAGG - Intergenic
1069953382 10:72034910-72034932 CTCCCAGAGGGCTGAGATTATGG - Intergenic
1073421930 10:103431331-103431353 CTCCCAGAGTGCTGAGATTATGG - Intronic
1075731520 10:124639327-124639349 CCCCAAGAGGGCTGAGGACAGGG + Intronic
1076741022 10:132485294-132485316 CTCCAAAAGCTCTAAGGCTATGG - Intergenic
1076833597 10:133008985-133009007 CCCAAAGTGCGCTGAGGCTGCGG - Intergenic
1079127808 11:17731223-17731245 CACCAGGAGGGCTGAGGCTCTGG + Intergenic
1081823445 11:46023006-46023028 CTCCCAAAGCGCTGAGATTATGG + Intronic
1082135715 11:48547130-48547152 CTCCAAGAGACCTGAAGCTGAGG - Intergenic
1083445827 11:62707509-62707531 CCCCAACAGAGCTGAGGCCAAGG - Intronic
1083799246 11:65036930-65036952 CTCCCAGAGTGCTGAGATTACGG + Intronic
1091099302 11:132855363-132855385 CTCCAAGAATGCAGAGACTAAGG - Intronic
1091537079 12:1421370-1421392 CCCCAAGAACTCAGAGGCTAGGG + Intronic
1091650138 12:2303505-2303527 CTCCAAAAGTGCTGGGGTTACGG - Intronic
1091860304 12:3775554-3775576 GTGCAAGAGCAGTGAGGCTAGGG - Intergenic
1093798113 12:23337699-23337721 CTCCAAGTTTGCTGTGGCTAGGG + Intergenic
1094230070 12:28092747-28092769 CTCCCAGAGAGCTGAAGCCACGG + Intergenic
1094822693 12:34239039-34239061 CTCCAAAAGCGCTGGGATTACGG + Intergenic
1095083388 12:38032332-38032354 CTCCAACAGACCTGAAGCTAAGG + Intergenic
1096734665 12:53643294-53643316 CTCCAAGAATTCAGAGGCTAGGG + Intronic
1096782057 12:53997238-53997260 CTCCAGGAAAGCTGAGGCTGGGG + Intronic
1097056911 12:56255867-56255889 CACCAAGTGTGCTGAGGCTCTGG - Exonic
1099960011 12:89387867-89387889 CTCCCAGAGTGCTGGGGTTACGG + Intergenic
1102694828 12:114790735-114790757 CTCCCAAAGTGCTGAGACTACGG - Intergenic
1104255003 12:127128264-127128286 CTGCACGTGCGCTGAGGCTGAGG + Intergenic
1115029508 14:28777930-28777952 CTCTTACAGCGCTGACGCTAAGG - Intronic
1117252908 14:53953598-53953620 CTCCCGGACCGCTGAGGCTCGGG - Intronic
1118768666 14:68927348-68927370 CTCCAAGAGCTCCCAGGCTGGGG - Intronic
1119139794 14:72256153-72256175 CCCCAAGAGCTCAGAGGCTAGGG + Intronic
1120705150 14:87738192-87738214 CTTCCAGAGGGCTCAGGCTAGGG - Intergenic
1122386703 14:101353239-101353261 CTCCCAGAGTGCTGAGATTATGG + Intergenic
1123941826 15:25220380-25220402 CTCTAAGTGCGCTGAAGCTTGGG + Intergenic
1123945707 15:25237873-25237895 CTCCAAGTGTGCTGAAGCTCAGG + Intergenic
1127041986 15:54987545-54987567 CTCCAAGAACTCAGAGGCTAGGG + Intergenic
1129191170 15:73938451-73938473 CTCCCAAAGTGCTGAGGTTATGG - Intronic
1130740601 15:86595776-86595798 CCCCAAGAACTCAGAGGCTAAGG + Intronic
1132847706 16:2008112-2008134 CTCCAGGAGCTCTGTGGCTGGGG - Intronic
1135891337 16:26360010-26360032 CCCCATGAGTGCTGAGACTAAGG + Intergenic
1136419857 16:30125013-30125035 CTCCCAGAGTGCTGAGATTACGG + Intergenic
1137402755 16:48166619-48166641 CTCCCAAAGTGCTGAGGTTATGG - Intergenic
1141016731 16:80457905-80457927 CCCCAAGAGCTCAGAGGCTAGGG + Intergenic
1143126019 17:4641369-4641391 CTCAAAGCGCGCGGAGGCCACGG - Intronic
1150217669 17:63479396-63479418 CCCCAAGAGCCCTCAGGCCAGGG + Intergenic
1150871660 17:68918674-68918696 CTCCCAAAGTGCTGAGACTATGG - Intronic
1152073442 17:78145263-78145285 CTCCCAGAGCCCCGAGGCCAGGG - Intergenic
1154287876 18:13077038-13077060 CTCCAAAAGTGCTGAGATTACGG + Intronic
1154418058 18:14196012-14196034 CTCCCAAAGTGCTGAGGTTACGG + Intergenic
1158180889 18:54713865-54713887 CTCCCAGAGTGCTGAGATTACGG + Intergenic
1159536283 18:69719174-69719196 CTCCAAGAGTTCCGAAGCTAGGG + Intronic
1162114715 19:8421906-8421928 CTCCAAGGTCGTGGAGGCTACGG + Exonic
1162965971 19:14156250-14156272 CTCAGTGAGCACTGAGGCTAGGG + Intronic
1163311272 19:16516320-16516342 CTCCCAGAGAGCTGGGACTACGG - Intronic
1163577406 19:18118700-18118722 CTCCAAGAGCGGTGAGGCTTTGG - Intronic
1163663438 19:18592021-18592043 CTGCAAGAGGGCTGTGGCTGTGG - Intronic
1163774137 19:19208168-19208190 CTCCAAGAGAGCTGGGTCTCAGG - Intergenic
1164840307 19:31388119-31388141 CTCCAGGAGGGCTGAGGCCAGGG - Intergenic
1165236872 19:34428640-34428662 CTCCAGGGGCTCTGAGGCTCAGG + Intronic
1165561719 19:36686277-36686299 CTCTAAGAGCCCTGAGGAAAGGG - Intergenic
1166514830 19:43438578-43438600 GCCCAAGAGCCCTGAGGGTAGGG + Intergenic
1167378572 19:49125570-49125592 CTTCAAGAGGGCTGGGGCTGGGG + Intronic
1167848975 19:52187846-52187868 CCCCAAGGTCTCTGAGGCTAGGG - Intergenic
1168333682 19:55584912-55584934 CTCCCAGATAGCTGAGACTACGG + Intergenic
1202646187 1_KI270706v1_random:144231-144253 CTCCCAAAGTGCTGAAGCTACGG + Intergenic
925043283 2:750773-750795 CTCCAAAAGCCCTGAGATTACGG + Intergenic
925764094 2:7214297-7214319 CTCCAGGACAGCTGAGGCTCTGG - Intergenic
927190937 2:20516462-20516484 CTCCAAGAGCCCTTTGTCTAAGG - Intergenic
927435297 2:23061253-23061275 CTCCCAAAGTGCTGAGACTAAGG + Intergenic
928365145 2:30694665-30694687 CTCCCAGAGCTCTCAGACTATGG - Intergenic
932465695 2:71922729-71922751 CTCCAAGGGGGCCGAGGCTGGGG - Intergenic
934032917 2:88064586-88064608 CTCCAAGAGTGCCTAGTCTAGGG + Intergenic
934072038 2:88393253-88393275 CTCCCAGAGTGCTGAGATTACGG + Intergenic
937160755 2:119759410-119759432 CTCCAGGAGCACTGAGGTTGGGG + Intergenic
937321009 2:120960776-120960798 CTCCCAGGGCACTGAGGCCAGGG + Intronic
937712796 2:124997221-124997243 CCCCAAGAACTCAGAGGCTAGGG + Intergenic
938032635 2:128008626-128008648 CTCCAAAAGCACTGGGGTTACGG + Intronic
938903877 2:135820746-135820768 CTCCAGGAGCGCTGAGGTTCTGG + Intronic
940389513 2:153115603-153115625 TTCTAAGAGCTCTGAGGGTAAGG + Intergenic
941960187 2:171245737-171245759 CTCCAAGAACTCAGGGGCTAGGG - Intergenic
942850178 2:180474922-180474944 CTCCAGCTGCCCTGAGGCTAGGG - Intergenic
942950792 2:181718731-181718753 CTCCCAAAGCGCTGAGATTATGG + Intergenic
947102058 2:226631249-226631271 CTCCAAGAGGCCTGAAGCCACGG + Intergenic
947191017 2:227504448-227504470 CTCCCAGAGTGCTGGGGTTATGG + Intronic
947539821 2:230968690-230968712 CTCCCAAAGTGCTGAGGTTACGG + Intergenic
948554216 2:238796114-238796136 CTCAAAGAGCCCGGAGGCTGAGG - Intergenic
1171010887 20:21508901-21508923 CTCCCAGGGCGCTGGGGTTAGGG + Intergenic
1172300663 20:33847610-33847632 CTCCTAGCACGCTGAGGCTGTGG - Intronic
1173741975 20:45407544-45407566 CTGCCAGAGCACTGAGGCTATGG - Intronic
1173942235 20:46921205-46921227 CTCCAAGCTCTCTGAGGCGAGGG - Intronic
1176605689 21:8828530-8828552 CTCCCAAAGTGCTGAAGCTACGG - Intergenic
1176924160 21:14726434-14726456 CTCCAAGAAATATGAGGCTAAGG - Intergenic
1176994749 21:15542475-15542497 CTCCAAGAGCTCTGAGGTGTGGG - Intergenic
1179457700 21:41510156-41510178 CTCCAAGAGGCCTGAGTCTGCGG - Intronic
1180347986 22:11720134-11720156 CTCCCAAAGTGCTGAAGCTACGG - Intergenic
1181324472 22:22034027-22034049 CTCCATGAGCAATGAGGCTGGGG + Intergenic
1181906728 22:26203404-26203426 CTCAGAGAGCTCAGAGGCTAGGG - Intronic
1182747790 22:32618827-32618849 CTCCTAGAGAGCTGAGCTTAAGG - Intronic
1185208901 22:49555633-49555655 CTCCAAGAGCTGTGAGGGAAGGG - Intronic
949436952 3:4039761-4039783 CTCCAAAAGTGCTGAGATTATGG - Intronic
952644384 3:35638875-35638897 CTCCAAGAGCGCTGAGGCTACGG + Intergenic
952927001 3:38327592-38327614 CCCTAAGAGCTCAGAGGCTAGGG + Intergenic
955248628 3:57254325-57254347 CTCCTAGAGGGCAGAGGCCATGG - Intronic
955489787 3:59470714-59470736 CCCCAAGAGCTCGAAGGCTAGGG - Intergenic
957588066 3:82158290-82158312 CCCCAAGAGCTCAGAGGTTAGGG - Intergenic
957617661 3:82552062-82552084 CTCCAAGAGCCCTGAGGTGGTGG + Intergenic
961198090 3:125020500-125020522 AACCAAGAACCCTGAGGCTAAGG + Intronic
961456288 3:127026183-127026205 TTCCAAGAGCTCAGAGGCCAGGG - Intronic
968485148 4:856831-856853 CTCCCAGAGCACTGGGGTTACGG + Intronic
968655454 4:1776646-1776668 TTGCAAGAGCCCTGAGGCCAGGG - Intergenic
973372420 4:49262459-49262481 CTCCCAAAGTGCTGAAGCTACGG + Intergenic
973669114 4:53196578-53196600 CTGCAAAGGCGCAGAGGCTAGGG - Intronic
973995685 4:56456347-56456369 CTCCCAAAGTGCTGAGGTTATGG + Intronic
974109643 4:57511413-57511435 CTCTAAGAGCGCTTGGGCTGGGG - Intergenic
974427733 4:61761534-61761556 CTCCTAAAGTGCTGGGGCTAAGG - Intronic
975118572 4:70705183-70705205 CTCCAGGAGCGCTGCTGCTGCGG - Intronic
975581549 4:75911458-75911480 CTCCAAGAACTCAGAGGCTAGGG + Intergenic
977630406 4:99236447-99236469 CTCCATGAGAGCTGAGGATGGGG + Intergenic
981725389 4:147842190-147842212 CTCCAAAAGCGCTAGGGTTATGG + Intronic
983147917 4:164241268-164241290 CCTCAAGAGTTCTGAGGCTAGGG - Intronic
984518736 4:180774843-180774865 CTCCCAGAGTGCTGAGATTATGG + Intergenic
985196672 4:187437811-187437833 CTCCAAGAACTCAGAGGCTAGGG + Intergenic
989357997 5:40566643-40566665 CTCCAACAGCCCTGAAGCTGAGG - Intergenic
993416479 5:87639356-87639378 CCCCAAGAACTCAGAGGCTAGGG + Intergenic
996397815 5:123031350-123031372 CTGCAGGAACGGTGAGGCTAAGG + Intronic
1000001448 5:157142631-157142653 CTCCGAGAGCGCGGAGGCCTCGG - Intronic
1001249740 5:170137922-170137944 CTCCCAGACTGCTGAGGCCAAGG + Intergenic
1003492385 6:6634915-6634937 CTCCAGCAGCGCAGAGGGTAAGG - Intronic
1006819816 6:36884002-36884024 CTCCCAAAGTGCTGAGGTTACGG - Intronic
1006876554 6:37302382-37302404 CTCCAAGAGCTTTTAGGCTTAGG + Intronic
1010176337 6:73032423-73032445 CTCCCAGAGTGCTGAGATTATGG + Intronic
1011696543 6:89918234-89918256 CCCCAAGGGCCCTGAGACTAAGG - Intergenic
1012258087 6:97056779-97056801 CTCCCAAAGTGCTGAGACTATGG - Intronic
1012840130 6:104319499-104319521 CTCCCAGAGTGCTGAGATTATGG + Intergenic
1012842274 6:104344326-104344348 CCCCAAGAGCTCAGAGGCTAGGG - Intergenic
1013474077 6:110491551-110491573 CCCCAAAAGCTCTGAGGCTAGGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014250453 6:119110447-119110469 CTGCAAGAGAGGTGAGGCAATGG + Intronic
1020120442 7:5500375-5500397 CTCCAGGAGTGCAGAGGCTGGGG - Intronic
1023762773 7:43482278-43482300 CTGCAAGAGCCCTCAGCCTAGGG + Intronic
1026834336 7:73628077-73628099 CTCCCAAAGTGCTGAGACTACGG + Intergenic
1026967932 7:74452320-74452342 CCCCAAGAACTCAGAGGCTAGGG + Intergenic
1029127729 7:98306321-98306343 GTCCACGAGAGCTGAGGCTTAGG + Intronic
1029510958 7:100994762-100994784 CTCCACGAGGCCTGAGGTTATGG - Exonic
1029511680 7:100999433-100999455 CTCCACGAGGCCTGAGGTTATGG - Exonic
1029512177 7:101002682-101002704 CTCCACGAGGCCTGAGGTTATGG - Exonic
1029609454 7:101618951-101618973 CTCCAAGAGTGCTCAGGGGAAGG - Intronic
1031390841 7:121212626-121212648 CTCCATGAGGGCAGGGGCTATGG + Intronic
1032247322 7:130224048-130224070 CTCCAAGAACTCAGATGCTAGGG + Intergenic
1033400180 7:141015243-141015265 CTCCAAAAGCTCTGAAGCAATGG + Intergenic
1034627206 7:152502901-152502923 CTCCCAGAGTGCTGAGATTATGG - Intergenic
1034628841 7:152514951-152514973 CTCCAAGGGCGCCGTGTCTACGG + Intergenic
1037853569 8:22352910-22352932 CTCACAGAGCCCTCAGGCTACGG - Intronic
1040855457 8:51944138-51944160 CTCCAAGGACTCAGAGGCTAGGG - Intergenic
1041465348 8:58152702-58152724 GTCCCAGAGCCCTGAGGCCAAGG - Intronic
1043946971 8:86264532-86264554 TTCCAAGAACTCAGAGGCTAGGG + Intronic
1043991927 8:86765783-86765805 CCCCAAAAGCTCAGAGGCTAGGG - Intergenic
1044659958 8:94585365-94585387 CTCCCAGAGTGCTGAGATTACGG + Intergenic
1045838648 8:106553575-106553597 CTCCAAAAGTGCTGAGATTACGG + Intronic
1047410738 8:124622535-124622557 CTCCAAGAGTGCTGGGATTATGG - Intronic
1055118725 9:72634043-72634065 CCCCAAGAGCTCAGGGGCTAGGG + Intronic
1056756208 9:89383486-89383508 CTCCAGGAGTGCTGAGGTCAGGG + Intronic
1056880519 9:90387563-90387585 CTGCAGGAGGGCTGAGGCTATGG - Intergenic
1060088788 9:120724915-120724937 CTTCAAAAGGGCTGAGGCCATGG - Intergenic
1060640001 9:125230406-125230428 CTCCATGACAGCTGAGGCCAGGG + Intronic
1203553083 Un_KI270743v1:180538-180560 CTCCCAAAGTGCTGAAGCTACGG - Intergenic
1185887529 X:3796293-3796315 CTCCCAGAGAGCTAAGGTTATGG - Intergenic
1190683344 X:52848789-52848811 CTCCAACAGACCTGAGGCTGAGG - Intergenic
1191668741 X:63729673-63729695 CTCAAAGAGCTCTGAGCCTTAGG + Intronic
1193281436 X:79655694-79655716 CTCCAACAGCCCTGAAGCTGAGG - Intergenic
1193978235 X:88150021-88150043 CTCCAAGAGCCTTGGGGCTCAGG - Intergenic
1200097566 X:153671344-153671366 CTCCAAGAGCTCTGGGGCTGGGG + Exonic