ID: 952647164

View in Genome Browser
Species Human (GRCh38)
Location 3:35674511-35674533
Sequence GGCATCATAATTTTTTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647164_952647170 9 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647170 3:35674543-35674565 AACCTGGGTATACTTTATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 107
952647164_952647166 -6 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647166 3:35674528-35674550 GATGCCTACCTACAAAACCTGGG 0: 1
1: 0
2: 1
3: 3
4: 88
952647164_952647172 20 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
952647164_952647169 8 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647169 3:35674542-35674564 AAACCTGGGTATACTTTATCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
952647164_952647165 -7 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647165 3:35674527-35674549 TGATGCCTACCTACAAAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647164 Original CRISPR GGCATCATAATTTTTTAATG TGG (reversed) Intronic