ID: 952647167

View in Genome Browser
Species Human (GRCh38)
Location 3:35674532-35674554
Sequence TATACCCAGGTTTTGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647167_952647174 25 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647174 3:35674580-35674602 GTGATTTTCTATGTGGCTTTTGG 0: 1
1: 0
2: 2
3: 53
4: 429
952647167_952647172 -1 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
952647167_952647173 18 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647173 3:35674573-35674595 CAGGCATGTGATTTTCTATGTGG 0: 1
1: 0
2: 2
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647167 Original CRISPR TATACCCAGGTTTTGTAGGT AGG (reversed) Intronic