ID: 952647168

View in Genome Browser
Species Human (GRCh38)
Location 3:35674536-35674558
Sequence AAAGTATACCCAGGTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647168_952647172 -5 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
952647168_952647174 21 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647174 3:35674580-35674602 GTGATTTTCTATGTGGCTTTTGG 0: 1
1: 0
2: 2
3: 53
4: 429
952647168_952647173 14 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647173 3:35674573-35674595 CAGGCATGTGATTTTCTATGTGG 0: 1
1: 0
2: 2
3: 20
4: 213
952647168_952647176 30 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647176 3:35674589-35674611 TATGTGGCTTTTGGAAAGATGGG 0: 1
1: 1
2: 2
3: 29
4: 362
952647168_952647175 29 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647175 3:35674588-35674610 CTATGTGGCTTTTGGAAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647168 Original CRISPR AAAGTATACCCAGGTTTTGT AGG (reversed) Intronic