ID: 952647172

View in Genome Browser
Species Human (GRCh38)
Location 3:35674554-35674576
Sequence ACTTTATCTGGGAATAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647164_952647172 20 Left 952647164 3:35674511-35674533 CCACATTAAAAAATTATGATGCC 0: 1
1: 0
2: 0
3: 34
4: 247
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
952647167_952647172 -1 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
952647168_952647172 -5 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647172 Original CRISPR ACTTTATCTGGGAATAATGC AGG Intronic