ID: 952647173

View in Genome Browser
Species Human (GRCh38)
Location 3:35674573-35674595
Sequence CAGGCATGTGATTTTCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647171_952647173 5 Left 952647171 3:35674545-35674567 CCTGGGTATACTTTATCTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 952647173 3:35674573-35674595 CAGGCATGTGATTTTCTATGTGG 0: 1
1: 0
2: 2
3: 20
4: 213
952647168_952647173 14 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647173 3:35674573-35674595 CAGGCATGTGATTTTCTATGTGG 0: 1
1: 0
2: 2
3: 20
4: 213
952647167_952647173 18 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647173 3:35674573-35674595 CAGGCATGTGATTTTCTATGTGG 0: 1
1: 0
2: 2
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647173 Original CRISPR CAGGCATGTGATTTTCTATG TGG Intronic