ID: 952647174

View in Genome Browser
Species Human (GRCh38)
Location 3:35674580-35674602
Sequence GTGATTTTCTATGTGGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647167_952647174 25 Left 952647167 3:35674532-35674554 CCTACCTACAAAACCTGGGTATA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 952647174 3:35674580-35674602 GTGATTTTCTATGTGGCTTTTGG 0: 1
1: 0
2: 2
3: 53
4: 429
952647171_952647174 12 Left 952647171 3:35674545-35674567 CCTGGGTATACTTTATCTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 952647174 3:35674580-35674602 GTGATTTTCTATGTGGCTTTTGG 0: 1
1: 0
2: 2
3: 53
4: 429
952647168_952647174 21 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647174 3:35674580-35674602 GTGATTTTCTATGTGGCTTTTGG 0: 1
1: 0
2: 2
3: 53
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647174 Original CRISPR GTGATTTTCTATGTGGCTTT TGG Intronic