ID: 952647175

View in Genome Browser
Species Human (GRCh38)
Location 3:35674588-35674610
Sequence CTATGTGGCTTTTGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647168_952647175 29 Left 952647168 3:35674536-35674558 CCTACAAAACCTGGGTATACTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 952647175 3:35674588-35674610 CTATGTGGCTTTTGGAAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 274
952647171_952647175 20 Left 952647171 3:35674545-35674567 CCTGGGTATACTTTATCTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 952647175 3:35674588-35674610 CTATGTGGCTTTTGGAAAGATGG 0: 1
1: 0
2: 1
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647175 Original CRISPR CTATGTGGCTTTTGGAAAGA TGG Intronic