ID: 952647621

View in Genome Browser
Species Human (GRCh38)
Location 3:35680777-35680799
Sequence AAGAAGAAAGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14831
Summary {0: 2, 1: 26, 2: 289, 3: 2356, 4: 12158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647621_952647625 18 Left 952647621 3:35680777-35680799 CCTCCCTCCTTCTCTTTCTTCTT 0: 2
1: 26
2: 289
3: 2356
4: 12158
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647621_952647626 21 Left 952647621 3:35680777-35680799 CCTCCCTCCTTCTCTTTCTTCTT 0: 2
1: 26
2: 289
3: 2356
4: 12158
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647621 Original CRISPR AAGAAGAAAGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr