ID: 952647625

View in Genome Browser
Species Human (GRCh38)
Location 3:35680818-35680840
Sequence TCTCACAGCTTAAAAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 360}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647619_952647625 24 Left 952647619 3:35680771-35680793 CCTCCTCCTCCCTCCTTCTCTTT 0: 1
1: 8
2: 115
3: 902
4: 5147
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647623_952647625 14 Left 952647623 3:35680781-35680803 CCTCCTTCTCTTTCTTCTTTTTT 0: 1
1: 18
2: 299
3: 2637
4: 15715
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647621_952647625 18 Left 952647621 3:35680777-35680799 CCTCCCTCCTTCTCTTTCTTCTT 0: 2
1: 26
2: 289
3: 2356
4: 12158
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647622_952647625 15 Left 952647622 3:35680780-35680802 CCCTCCTTCTCTTTCTTCTTTTT 0: 1
1: 34
2: 313
3: 2487
4: 14473
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647618_952647625 28 Left 952647618 3:35680767-35680789 CCTTCCTCCTCCTCCCTCCTTCT 0: 1
1: 48
2: 326
3: 1302
4: 6055
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647624_952647625 11 Left 952647624 3:35680784-35680806 CCTTCTCTTTCTTCTTTTTTTTT 0: 2
1: 77
2: 1677
3: 11924
4: 62044
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360
952647620_952647625 21 Left 952647620 3:35680774-35680796 CCTCCTCCCTCCTTCTCTTTCTT 0: 2
1: 14
2: 131
3: 1068
4: 5718
Right 952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG 0: 1
1: 0
2: 2
3: 28
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647625 Original CRISPR TCTCACAGCTTAAAAAAGTG AGG Intronic
901193458 1:7426169-7426191 TTTAACAGTTTAAAAAGGTGAGG + Intronic
902272991 1:15318028-15318050 TCTTACAGCTGAGAAAACTGAGG + Intronic
902812968 1:18899643-18899665 TTTCACAGATTAAACAACTGAGG - Intronic
903000865 1:20264719-20264741 TCTCACAACTAAATCAAGTGTGG - Intergenic
903686290 1:25134796-25134818 TTTCACAGATTAAGAAACTGAGG + Intergenic
904812953 1:33175700-33175722 TCTCACAGATGAAGAAAATGAGG - Intronic
907756774 1:57318409-57318431 TCCCACAGCTTAAAATACTCTGG + Intronic
907770617 1:57459946-57459968 TCTTACAGATTAGAAAACTGAGG - Intronic
907901213 1:58742979-58743001 TCTCACAGATGAGAAAACTGAGG - Intergenic
908216441 1:61958805-61958827 TTTTACAGATTAAGAAAGTGAGG - Intronic
908638590 1:66196442-66196464 TGTCAAACCTTCAAAAAGTGAGG + Intronic
909077585 1:71070037-71070059 CCTGAAAGCTTAACAAAGTGGGG - Intronic
909101210 1:71351546-71351568 ATTCACAGCTATAAAAAGTGTGG + Intergenic
910128597 1:83874785-83874807 TTTTACAGCTGAGAAAAGTGAGG - Intronic
910334745 1:86114795-86114817 TCTCAAACCTAAAAAAAGTGTGG - Intronic
911507345 1:98769580-98769602 TCTCTCACTTTAAAAAAGAGAGG - Intergenic
912641524 1:111350736-111350758 TTTTACAGATTAAAAAACTGAGG - Intronic
913231402 1:116743333-116743355 TCTCACAGTTCAAAAAATTCAGG + Intergenic
915211639 1:154313853-154313875 TCACACAGCTTAGGAAATTGAGG - Intergenic
915212761 1:154322844-154322866 TCACACAGCTTAGGAAATTGAGG - Intronic
916443292 1:164848342-164848364 TCTCACAGATGAAGAAAATGAGG - Exonic
917334806 1:173916126-173916148 TTTCACATTTTAAAAAAATGAGG + Intronic
917344162 1:174011695-174011717 TTTCACAGCTTGAAAAATGGAGG - Intronic
917431110 1:174970151-174970173 TCTCACAGCTTCCAAATGGGTGG - Intronic
917449082 1:175131774-175131796 TCTAACAGTTTAGAAAAGTGAGG + Intronic
918577554 1:186081120-186081142 TCTGACAGCTTTAAAAACTTTGG - Intronic
918883246 1:190154902-190154924 TATCAAAACTTAAAAAAATGAGG + Intronic
918924546 1:190765045-190765067 TCTTACAGCTTTGAAATGTGAGG + Intergenic
920123021 1:203672929-203672951 TCTCAAAGACTAAAAAAATGTGG + Intronic
922951882 1:229565028-229565050 TCTCACTGCAAAAATAAGTGGGG - Intergenic
924508113 1:244704957-244704979 TGTCTCAAATTAAAAAAGTGTGG - Intronic
924921234 1:248631390-248631412 TCTCACAGCTGGTAAAACTGAGG + Intergenic
1063164140 10:3444560-3444582 TTCCACAGCTCAGAAAAGTGAGG + Intergenic
1063352516 10:5368472-5368494 TCTCACAGAGGAAAATAGTGAGG + Intronic
1064188693 10:13186431-13186453 ACTGCCAGTTTAAAAAAGTGAGG + Intronic
1064766715 10:18682818-18682840 TCTAAAAGCTGAAAAAGGTGAGG - Intergenic
1065394513 10:25219666-25219688 TCTCACAGGTTAAAGAACAGAGG + Intronic
1065744700 10:28829606-28829628 TCTCCCAGCTTAAGAAAGAAAGG - Intergenic
1066498848 10:35970696-35970718 TCTTGCTGTTTAAAAAAGTGTGG + Intergenic
1066659307 10:37724651-37724673 TCTAAGATCTTAAACAAGTGTGG + Intergenic
1069041544 10:63700721-63700743 TGTCAGAGCTTAAAGAAGTTTGG - Intergenic
1069164583 10:65136893-65136915 TTTTACAGGTTAAAAAACTGAGG - Intergenic
1070192962 10:74129476-74129498 TTTAACAGATTAAAAAACTGAGG + Intronic
1071576527 10:86730660-86730682 CTTCACAGCTGAAAAAACTGGGG - Intronic
1073605039 10:104886009-104886031 TTTAACAGCTGAAAAAACTGAGG + Intronic
1074251573 10:111755988-111756010 TCTCATAGCTCAACAAAATGTGG + Intergenic
1074336496 10:112581472-112581494 TCTTGCAGATTAGAAAAGTGAGG - Intronic
1074836407 10:117300150-117300172 TCTCACAGGTTAAAAAAACTGGG + Intronic
1075568077 10:123519069-123519091 TTTTACAGATTAAAAAACTGAGG - Intergenic
1076419735 10:130322526-130322548 TCTGATTGCTTAAAAGAGTGTGG - Intergenic
1076489457 10:130847609-130847631 GCTGACAGCTCAAAAAAATGAGG + Intergenic
1078540551 11:12209811-12209833 TCTTACAGCTGAGAAAACTGAGG - Intronic
1078565547 11:12410951-12410973 TTTTACAGCTGAGAAAAGTGAGG - Intronic
1078829521 11:14966240-14966262 CCTCACAGAATAAAAAAGTTGGG + Intronic
1078913153 11:15751929-15751951 TTTCACAGATTAAGAAACTGGGG + Intergenic
1080648933 11:34207662-34207684 TCTTACAGCTGAGAAAACTGAGG + Intronic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1081534851 11:43989236-43989258 TCTCACAGGTGAGAAAACTGAGG - Intergenic
1081594189 11:44447768-44447790 TTTTTCAGCTTAAAAAACTGAGG - Intergenic
1081725884 11:45328801-45328823 TTTCACAGCTGAGAAAACTGAGG + Intergenic
1083293394 11:61702287-61702309 TCTGACAGATTTCAAAAGTGGGG + Intronic
1084589467 11:70082060-70082082 TCTCACAGATGAGAAAACTGAGG + Intronic
1085625147 11:78066168-78066190 TCTCAAAATTTAAAAAGGTGGGG - Intronic
1085696323 11:78707831-78707853 TTTCACAGATATAAAAAGTGAGG + Intronic
1085708877 11:78811388-78811410 TCTCACAAATTAAGAAACTGAGG - Intronic
1085904915 11:80748853-80748875 TCTCTCAGCATCAAAATGTGAGG - Intergenic
1086471239 11:87113821-87113843 TCTCACAGCTGAGAAAATGGAGG - Intronic
1086796955 11:91117126-91117148 TCTTACAGCTGAAAAAAGATTGG - Intergenic
1087632296 11:100664594-100664616 TATCACAGCTTAGAAAACTGAGG + Intergenic
1087710829 11:101548497-101548519 TCTCACAGATGAGGAAAGTGAGG + Intronic
1087952994 11:104248032-104248054 TCTCTGAGCTTAAAATAATGTGG + Intergenic
1088090575 11:106034690-106034712 TCTCACAGCTAACAAAAGAAAGG + Intergenic
1088739658 11:112756863-112756885 TCTCACAGCTGAGGAAACTGAGG + Intergenic
1088988514 11:114930105-114930127 TCTCACACATTAAATAATTGTGG - Intergenic
1089348682 11:117808922-117808944 TCTCACAGATGAGAAAACTGAGG + Intronic
1089884010 11:121801932-121801954 TCTCACTGCATAAACAAATGGGG - Intergenic
1089893350 11:121903245-121903267 TTTCACAGCTGAAGAAACTGAGG - Intergenic
1089895018 11:121921447-121921469 TTTTACAGGTTAAAAAATTGAGG - Intergenic
1090354074 11:126127758-126127780 TCTCACAGATCAAGAAACTGAGG - Intergenic
1090453319 11:126825798-126825820 TTTCACAGATAAAAAAACTGGGG + Intronic
1091137771 11:133207551-133207573 TTTCACAGATGGAAAAAGTGAGG - Intronic
1091511234 12:1128607-1128629 TCTCACAGATGAGAAAACTGAGG - Intronic
1091660229 12:2377706-2377728 TTTCACAGCTGAGTAAAGTGAGG + Intronic
1093390469 12:18613299-18613321 TCTAAGAGCCTAAGAAAGTGTGG - Intronic
1094466517 12:30759127-30759149 TCCCACCACTTAAAAAAATGTGG - Intergenic
1094625404 12:32118966-32118988 TCTCACAACTGAAATATGTGTGG - Intronic
1097069017 12:56341256-56341278 AGTCACAGCATCAAAAAGTGTGG + Intergenic
1097372627 12:58802818-58802840 TCTGACAGCATTAAAATGTGTGG + Exonic
1098355229 12:69606174-69606196 TCTCCCATCTTCAAGAAGTGTGG + Intergenic
1098864325 12:75744788-75744810 TCCTACAGCTGAAAAAAGAGGGG + Intergenic
1100824759 12:98464167-98464189 TGTCACAGTTCATAAAAGTGAGG - Intergenic
1100913176 12:99388618-99388640 TCTCACAGTTTACAAGAGTCAGG + Intronic
1101486278 12:105164475-105164497 ACTCACATCTTAAAAATGGGCGG + Intronic
1101488233 12:105187428-105187450 TTTTACAGCTGAAAAAACTGAGG + Intronic
1101572803 12:105970599-105970621 TCTCACAGATGAGAAAACTGAGG - Intergenic
1101826059 12:108220987-108221009 TCTCACAGATGAGAAAACTGAGG - Intronic
1103349774 12:120276090-120276112 TCTCACAGATGAGAAAACTGAGG - Intergenic
1104014220 12:124951474-124951496 ACTCACAGCTTACATATGTGGGG + Intronic
1107094724 13:36523724-36523746 TCACACAGCTTATAAGAGTCAGG + Intergenic
1107439525 13:40412841-40412863 TTTCACAGTTTAAAAAAATGAGG + Intergenic
1108167635 13:47709748-47709770 TCTCACAGCTAGAAAAAATTAGG - Intergenic
1109162121 13:58988587-58988609 TCTGACAGTTTAAAAGTGTGGGG + Intergenic
1109966278 13:69701164-69701186 TCTCATAGCTTAGGAAAATGAGG + Exonic
1110815590 13:79857081-79857103 CTTCACAGCCAAAAAAAGTGTGG + Intergenic
1112936970 13:104812789-104812811 TTTCATAGCTTTAAAAAGTTGGG - Intergenic
1115006605 14:28492917-28492939 ACTCAACTCTTAAAAAAGTGAGG + Intergenic
1117093248 14:52270731-52270753 TGTCACAGCATAGATAAGTGAGG - Intronic
1117109944 14:52442033-52442055 TTTCACAGATTTAAAAACTGGGG - Intronic
1118606796 14:67510120-67510142 TCTCACAGCTGGAAACACTGAGG - Intronic
1118752745 14:68818394-68818416 TTTCACATCTGAAAAATGTGGGG + Intergenic
1119401098 14:74362881-74362903 TCTTACAGATGGAAAAAGTGAGG - Intergenic
1120829474 14:88985375-88985397 ACTTACAGATTAGAAAAGTGAGG + Intergenic
1120941950 14:89957396-89957418 TTTCACAGACTAAAAAACTGAGG + Intronic
1121154405 14:91669290-91669312 TCTGACAGTTTTAAAAAGTAAGG - Intronic
1121912894 14:97808186-97808208 TGTTACAGATGAAAAAAGTGAGG + Intergenic
1121973092 14:98377152-98377174 TGTCACAACTTAAAAATGTTGGG - Intergenic
1124636712 15:31369903-31369925 TCTCACAGCTTAATAGAGAGAGG - Intronic
1124862170 15:33452678-33452700 TTTCACAGCCAAAAAAATTGAGG + Intronic
1125963326 15:43851440-43851462 TTTCACAGCTAAGGAAAGTGAGG - Intronic
1126415874 15:48416993-48417015 TTTTACAGCTGAAGAAAGTGAGG + Intronic
1126963905 15:54029739-54029761 TCACACAGCTTCAGAAGGTGCGG + Intronic
1127117371 15:55742324-55742346 TCTCGCAGCCCTAAAAAGTGGGG + Intronic
1127315097 15:57787712-57787734 TCTCACAGATGAAGAAACTGAGG + Intergenic
1127962817 15:63902493-63902515 TTTCACAGATTAGAAAACTGAGG + Intergenic
1128031408 15:64483846-64483868 TCTCACAGATGAAATAACTGAGG + Intronic
1130127820 15:81108676-81108698 CCTCACAGATTTAAAAAGGGTGG - Intronic
1130720158 15:86378707-86378729 TTTCACAGCTGAACAAATTGAGG + Intronic
1131779402 15:95840487-95840509 TTTCACAGATAAAAAAACTGAGG + Intergenic
1131792580 15:95981121-95981143 GCTGAGAGGTTAAAAAAGTGTGG - Intergenic
1133607078 16:7398317-7398339 TCTTACAGATGAAGAAAGTGAGG - Intronic
1133722411 16:8507343-8507365 TTTCACAGGTGAAAAAACTGAGG + Intergenic
1133842473 16:9422191-9422213 ACTTACAGCTTAAGACAGTGTGG + Intergenic
1134560326 16:15203526-15203548 TCTCACAGATGAAGAAACTGAGG + Intergenic
1134906232 16:17982144-17982166 TCTCACAGTTTCCACAAGTGAGG + Intergenic
1134920866 16:18115140-18115162 TCTCACAGATGAAGAAACTGAGG + Intergenic
1135053126 16:19208480-19208502 TCTGACAGTTTAAAAATGTGTGG - Intronic
1135157619 16:20066858-20066880 TCTCACAGCTGAAGAAACTGAGG + Intronic
1135386386 16:22044673-22044695 TTTCACAGATGAAGAAAGTGAGG + Intronic
1135730982 16:24894869-24894891 TCTCACAGCCTCCCAAAGTGCGG - Intronic
1135780933 16:25299992-25300014 TTTCACAGATTAGAAAAGTGAGG + Intergenic
1135908884 16:26541238-26541260 ACTCAAAGCTTAAGAAATTGAGG - Intergenic
1137719107 16:50617290-50617312 TCCCCCAGTTTAAAAAAGGGAGG - Intronic
1138291649 16:55853185-55853207 TTTCACAGATTAAGAAACTGAGG + Intronic
1138935122 16:61710205-61710227 TGTCACAGATTAGAAAACTGAGG + Intronic
1139831701 16:69803954-69803976 AATCACAGCTTTAAAAAGTAGGG - Intronic
1140078769 16:71724719-71724741 TCTCACAGCTTAAGAACGAAAGG - Intergenic
1140322342 16:73965400-73965422 TTTCACAGATTAGAAAACTGAGG + Intergenic
1140959912 16:79901874-79901896 TTTCACAGATGAAAAAATTGAGG + Intergenic
1140962437 16:79929401-79929423 TTTTACAGATTAAAAAACTGAGG + Intergenic
1141836947 16:86547035-86547057 TCTTACAGCTGAAGAAACTGAGG - Intronic
1141901021 16:86990600-86990622 TCTGATAGCTTAAAAGTGTGTGG - Intergenic
1142952162 17:3492222-3492244 TCTTACAGCCTCAAAAAGTGTGG - Intronic
1143501138 17:7339831-7339853 TACCACAGATTAAAGAAGTGTGG - Intronic
1143678767 17:8459740-8459762 CCTTACAACTAAAAAAAGTGTGG - Intronic
1144076975 17:11728330-11728352 ACGCTCAGCTTAATAAAGTGAGG + Intronic
1144826635 17:18108960-18108982 CCTCACAGATGAACAAAGTGAGG - Intronic
1145320668 17:21765459-21765481 TCTCCCAGCTGAAACCAGTGAGG + Intergenic
1145900428 17:28487395-28487417 TTTCACAGCTGAAAAAAGAAAGG - Intronic
1148674516 17:49437648-49437670 TCTCAGAGAAAAAAAAAGTGGGG - Intronic
1152649583 17:81486033-81486055 TATCACAGTTTAAAAAATTATGG - Intergenic
1152821253 17:82439016-82439038 CCTCACAGCTGAAGAAACTGAGG + Intronic
1153506485 18:5804356-5804378 TCTGACAGTTTAAAAATGTATGG + Intergenic
1153887898 18:9483649-9483671 TCTCACACCATATAAAAATGTGG - Intronic
1154308498 18:13248265-13248287 AATCACAGCTCAAAAAAGTGGGG - Intronic
1155463904 18:26114549-26114571 TCTCATGGTTTAAAAATGTGTGG + Intergenic
1155557814 18:27040841-27040863 TCACACAGGGTAAAAAAATGAGG - Intronic
1156201766 18:34841173-34841195 TCCCACAGCTATAAAAAGTGGGG + Intronic
1157282149 18:46353287-46353309 TCTCTCAGATGAGAAAAGTGAGG - Intronic
1160596693 18:79980446-79980468 ACACACAGCCTAAAAAAATGAGG + Intronic
1162104439 19:8361901-8361923 TCTCTCAGTTTAAGAAGGTGGGG + Intronic
1162485626 19:10958926-10958948 TTTCACAGGTGAAGAAAGTGAGG + Intergenic
1163126124 19:15245168-15245190 TCTTACAGCTGAGAAAAGTGGGG + Intronic
1164426074 19:28142819-28142841 TCTCCCAGATTAAAAATGTTTGG + Intergenic
1164943749 19:32272453-32272475 TTTCACAGATAAAAAAACTGAGG - Intergenic
1165708534 19:37993186-37993208 TCTCACAGATGAAGAAACTGAGG - Intronic
1165953143 19:39485927-39485949 TCTCCCAGCTGAAGAAAGCGAGG - Intronic
1166011779 19:39948008-39948030 TCTGATAGCTTAAAAGTGTGTGG + Intergenic
1166413920 19:42577982-42578004 TTTTACAGATTAAAAAAATGAGG - Intergenic
1166535610 19:43572501-43572523 TATCACAGTTTAAAAGACTGAGG + Intronic
925629606 2:5877216-5877238 TCTCAGTGTTTAAAAAAGTGTGG + Intergenic
925813559 2:7725094-7725116 TGACACAGCTTAAAAAAGAAAGG - Intergenic
926076244 2:9945488-9945510 TCCCACAGCTGAGGAAAGTGAGG + Intergenic
926108388 2:10166599-10166621 TTTCACAGCTGAAGAAACTGAGG + Intronic
926166277 2:10523547-10523569 CCTCACAGCAGAAACAAGTGAGG - Intergenic
927481970 2:23461198-23461220 TCTCACAGCTGAAGAGACTGAGG + Intronic
927761835 2:25763767-25763789 TTTCACAGATGAAGAAAGTGAGG + Intronic
927849532 2:26490124-26490146 TTTCACAGCTCAAAAAACTGAGG - Intronic
928330457 2:30354172-30354194 TCTCAAAGGTCAAATAAGTGAGG - Intergenic
928601898 2:32911845-32911867 ACACACAGCTTATAAAATTGTGG - Intergenic
928834418 2:35525983-35526005 TCTCACAGCAAAGAAAAGTATGG - Intergenic
928942061 2:36736175-36736197 TCTAACAGATTACCAAAGTGTGG + Intronic
929301020 2:40303784-40303806 TCTCAGACCTGAAGAAAGTGAGG - Intronic
930020245 2:46997511-46997533 TCTTACAGATGACAAAAGTGAGG + Intronic
930244343 2:48968073-48968095 GCTAACTGGTTAAAAAAGTGAGG - Intronic
930410560 2:51020578-51020600 TTTCAAAGCTTAAAAATTTGTGG - Intronic
930687905 2:54329218-54329240 TCTCAGGGCTTAAAGAAATGAGG - Intergenic
931396739 2:61894392-61894414 ATTCCCAGCCTAAAAAAGTGAGG + Intronic
932784561 2:74588536-74588558 TCTAACAGCTTACAACGGTGAGG + Intronic
933221191 2:79691168-79691190 TGACAGAGCATAAAAAAGTGTGG + Intronic
933764537 2:85697767-85697789 TCTCCCAGCTTGGGAAAGTGTGG + Intronic
935926569 2:108076086-108076108 TCCCACAGATTAAAACAGTGAGG + Intergenic
936979219 2:118248914-118248936 TCCCACAGCTTTAAACAGTGTGG + Intergenic
937446630 2:121963669-121963691 TCTAAAAGCTGAAAAAAGTGTGG + Intergenic
937547727 2:123044412-123044434 TCTCACTGGTTATAAATGTGAGG - Intergenic
937767866 2:125682386-125682408 TCTCAATGCTTATAAAAGTTAGG - Intergenic
938798047 2:134735194-134735216 TCTTACAGCTGAGAAAACTGAGG + Intergenic
939165246 2:138634441-138634463 TCTTACAGATGTAAAAAGTGAGG + Intergenic
939829612 2:147056418-147056440 TATCACTGTTGAAAAAAGTGAGG - Intergenic
940088902 2:149894617-149894639 TTTCACAGATTAAGAAATTGAGG + Intergenic
940432782 2:153612989-153613011 TTTGGCAGCTTAACAAAGTGAGG - Intergenic
940698297 2:157008649-157008671 TCTCACTGCTCAAATAAGTTGGG - Intergenic
941681567 2:168405147-168405169 TAGCACATCATAAAAAAGTGGGG - Intergenic
942067967 2:172289625-172289647 TTTCATAGCTGAAGAAAGTGAGG - Intergenic
942536665 2:176972218-176972240 TATCACAGCTTCAAACTGTGAGG + Intergenic
944415577 2:199476226-199476248 TTTGACAGATTAAAAAAATGAGG - Intergenic
945051399 2:205827567-205827589 TCTGAGAGTTAAAAAAAGTGAGG - Intergenic
945632500 2:212299119-212299141 TCTCACAGACCAAAAGAGTGAGG + Intronic
946866867 2:224048765-224048787 TCTCACAGCCTCCCAAAGTGGGG + Intergenic
1168856338 20:1011808-1011830 TTTCACAGATGAAAAAAGTGAGG - Intergenic
1172148397 20:32773571-32773593 TTTCACAGATTATAAAACTGGGG + Intronic
1172207004 20:33170105-33170127 TTTCACAGCTGAGAAAACTGAGG + Intronic
1173872274 20:46349613-46349635 TTTCACAGATTAAAAAACTACGG + Exonic
1174669100 20:52289450-52289472 TCTCACAGATAAGAAAACTGAGG - Intergenic
1175478870 20:59297539-59297561 TCTCACAGATTAAAAAACTAAGG - Intergenic
1175502043 20:59457343-59457365 TCTCACAGGTTGGAAAACTGAGG + Intergenic
1178140243 21:29674621-29674643 TCTGATGGTTTAAAAAAGTGTGG + Intronic
1178163449 21:29945415-29945437 TATCACAGCTAAAGAAACTGAGG + Intergenic
1178938935 21:36888750-36888772 TCTCACAGCTGAAGACAGTAAGG + Intronic
1179276143 21:39893480-39893502 TCACACAGCTTCAGAAAGCGAGG - Intronic
1181750944 22:24988898-24988920 TCTCACAGTTGGAAAAACTGAGG + Intronic
1181941937 22:26484336-26484358 TCTCACAGATGAGAAAACTGAGG - Intronic
1182308270 22:29386643-29386665 TCACACAGCTTAAAAAAAAAAGG + Intronic
1184466810 22:44673282-44673304 TTTCACAGATTAGAAAACTGAGG - Intronic
949769534 3:7564323-7564345 TTTCACAGATGAAAAAAATGAGG + Intronic
951848233 3:27108011-27108033 TCACACATCTTAAAAATGAGTGG + Intergenic
952647625 3:35680818-35680840 TCTCACAGCTTAAAAAAGTGAGG + Intronic
952961388 3:38592402-38592424 ACTCACAGCTTGTAAGAGTGTGG - Intronic
953156723 3:40381981-40382003 TTTCACAGATGAAAAAATTGAGG + Intergenic
953402599 3:42638980-42639002 TCCCACAGCTTTAAATACTGAGG + Exonic
954706585 3:52484102-52484124 TCTTACAGATTACAAAAATGAGG - Intronic
954796549 3:53164211-53164233 TTACACAGCTGAAAAAACTGAGG - Intronic
955878799 3:63522308-63522330 TCTCACAGACTAAGAAACTGAGG - Intronic
956285982 3:67610741-67610763 TCACACAGATCATAAAAGTGAGG + Intronic
956453640 3:69399221-69399243 CCCCACAGCTTAGAAGAGTGTGG + Intronic
956736023 3:72238881-72238903 TTTCACAGCTTCTCAAAGTGTGG + Intergenic
956857800 3:73293120-73293142 TTTCAGAGCTAAAAAAACTGAGG + Intergenic
960614379 3:119583380-119583402 TCTCACCACAAAAAAAAGTGAGG + Intronic
960974404 3:123160802-123160824 TTTTACAGCTGAAAAAAATGAGG + Intronic
961258833 3:125582766-125582788 TCCCACAGCTTCTAAAAGTTTGG - Intronic
961338212 3:126198230-126198252 TTTAACAGCTTATTAAAGTGGGG + Intergenic
961418095 3:126776411-126776433 TCTCTCAGCTCAGTAAAGTGAGG + Intronic
965204800 3:165708192-165708214 TTTCAGAGCTTAAAATACTGAGG - Intergenic
965549929 3:169953864-169953886 TCTCACAGATTAGAAAATGGAGG - Intergenic
966311387 3:178597907-178597929 TCTCAAAAGTTAAAAAATTGGGG + Intronic
966347075 3:178991745-178991767 TTTCACATATTAGAAAAGTGAGG - Intergenic
967102968 3:186231419-186231441 TCTTACAGATGAGAAAAGTGAGG - Intronic
968046555 3:195626952-195626974 TCTCACAGCTTTGAAGACTGGGG - Intergenic
968308098 3:197663089-197663111 TCTCACAGCTTTGAAGACTGGGG + Intergenic
969373352 4:6747839-6747861 TCTCACAGATGGAAAAACTGAGG + Intergenic
969996287 4:11316516-11316538 TCTCATAGTTTTAAAAAGAGGGG - Intergenic
970674416 4:18432347-18432369 ACTCAAAGCCTAAAGAAGTGAGG + Intergenic
970978637 4:22071402-22071424 CCTTACAGGTTACAAAAGTGAGG - Intergenic
970978664 4:22071757-22071779 TCTTACAGGTTACAAAAGTGAGG - Intergenic
970983891 4:22132711-22132733 TCTCAAGGCATAAAAAAGGGAGG - Intergenic
972280353 4:37596205-37596227 TTTCACAGATGAGAAAAGTGAGG - Intronic
974181698 4:58392030-58392052 TCTCACAGCTGAAAGAAAAGTGG - Intergenic
974424028 4:61717521-61717543 TTTCACAGATAAAACAAGTGAGG - Intronic
975102799 4:70533869-70533891 TTTTACAGATTAAAAAAATGAGG - Intergenic
976447318 4:85146010-85146032 TTTCACAGATTAAAAAAGTGAGG - Intergenic
977210234 4:94209999-94210021 TTTCAGAGATGAAAAAAGTGTGG - Intronic
977675428 4:99741837-99741859 TTTTACAGCTGAAAAAACTGAGG - Intergenic
978383973 4:108161789-108161811 ACTCACAGCTGAAAAACGTAAGG + Intronic
978870913 4:113576328-113576350 TCTGACTGTTTAAAAAGGTGAGG - Intronic
980296894 4:130931278-130931300 TCTTACAGATTAAAAATGTCTGG - Intergenic
981198559 4:141949915-141949937 TCTCATTGTTTAAAAGAGTGTGG + Intergenic
981358154 4:143815601-143815623 TCTGATGGCTTAAAAGAGTGTGG + Intergenic
981369400 4:143941720-143941742 TCTGATGGCTTAAAAGAGTGTGG + Intergenic
981379142 4:144051662-144051684 TCTGACAGCTTAAAAGAGTGTGG + Intergenic
981482525 4:145253573-145253595 ACTCACTGCTTAAAAAAGGGGGG - Intergenic
981679164 4:147375118-147375140 TCTCACAGCAACAAAAACTGGGG - Intergenic
981767287 4:148265863-148265885 TCTCAGTGCTTAGAACAGTGGGG - Intronic
981875726 4:149542877-149542899 TTTTACAGCTGAAAAAAGTGGGG + Intergenic
982062141 4:151615351-151615373 TCTTACAGCTAAGAAAAGTGAGG - Intronic
984582721 4:181529074-181529096 TTTCACAGGTGAAAAAACTGAGG + Intergenic
986806992 5:11317178-11317200 TCTTACAGGTTAAGAAACTGAGG + Intronic
987168336 5:15224734-15224756 CCCCACAGCTTAGAAGAGTGTGG + Intergenic
988543348 5:32133182-32133204 TTTCACTGCTTAATCAAGTGGGG + Intronic
989089630 5:37716614-37716636 TCTCACAGATGAAGAAACTGAGG - Intronic
989433321 5:41381106-41381128 TCTTACAGATTTAAAAAATGAGG - Intronic
989475915 5:41872437-41872459 TCTCCCAGTTTTTAAAAGTGTGG - Intergenic
989998818 5:50868337-50868359 TTTGACAACTTAAAAAACTGAGG + Intergenic
990235638 5:53764698-53764720 CCTCATAACTTAAAAAAGAGAGG + Intergenic
991240668 5:64456143-64456165 TTTCTCAGTTTTAAAAAGTGAGG - Intergenic
991418296 5:66414319-66414341 TTTAACAGATTAGAAAAGTGAGG + Intergenic
992048594 5:72923286-72923308 TCTAAGATCTTAAAATAGTGTGG + Intergenic
992365964 5:76089828-76089850 TTTCACAGCTGAAAAAATTTAGG - Intronic
992719897 5:79550528-79550550 TCTCAAAGATTAAAAAAATTAGG + Intergenic
993224500 5:85150219-85150241 TCTCATCTCTTAAAAAAATGTGG - Intergenic
995009603 5:107242289-107242311 TTTCTCAGCTTAAAATATTGAGG + Intergenic
995203509 5:109452757-109452779 TCTCACAGATAAGGAAAGTGTGG + Intergenic
996877993 5:128261070-128261092 TCTTACAGGTGAAAAAACTGAGG + Intronic
997856195 5:137374806-137374828 TCTCACAGATAAGGAAAGTGAGG + Intronic
999044772 5:148455164-148455186 TCTTACAGATTAGAAAACTGAGG + Intronic
999437252 5:151572568-151572590 TCTCACAGATGAAAAAGCTGAGG - Intergenic
999737155 5:154521450-154521472 TCCAACAGTTCAAAAAAGTGAGG + Intergenic
999856280 5:155597985-155598007 TCTTAAAGCTAAAAAAACTGAGG + Intergenic
999911402 5:156204624-156204646 TCTCTCAGATGAAGAAAGTGAGG - Intronic
1000623911 5:163517126-163517148 TCTCATATATTAAAAAACTGTGG - Intronic
1000807439 5:165813308-165813330 TCGCACAGTTAAAAAAACTGTGG + Intergenic
1001052715 5:168425812-168425834 TCTTAAAGATGAAAAAAGTGAGG + Intronic
1001062551 5:168505176-168505198 TCTTACAGTTTAGAAAATTGAGG - Intronic
1001271328 5:170314376-170314398 TTTCACAGCTGAGAAAACTGAGG - Intergenic
1001494155 5:172176156-172176178 TTTCACAGCTTAAGAAACTGAGG + Intronic
1001810122 5:174621233-174621255 TTTCACAGATTAGGAAAGTGAGG + Intergenic
1002056088 5:176598610-176598632 TCTCACATCTTTGAAAAATGTGG - Exonic
1002379338 5:178814531-178814553 ACTCACAGCTAAAAGAAGAGTGG + Intergenic
1004643570 6:17538788-17538810 TTTCACTGCTTAAAAAGGTTCGG + Intronic
1005852790 6:29834841-29834863 TTTCACAGATTAAGAAACTGAGG + Intergenic
1005876394 6:30013348-30013370 TTTCACAGATTAAGAAACTGAGG + Intergenic
1005910587 6:30306211-30306233 TCTCACAGCTTAGTAAATTATGG + Intergenic
1008548466 6:52604659-52604681 TCTCAGATATTCAAAAAGTGGGG + Intergenic
1009589354 6:65646040-65646062 ATTCCCAGCTAAAAAAAGTGCGG + Intronic
1010845946 6:80707733-80707755 TTTTACAGCTAAAAAAACTGTGG - Intergenic
1012226414 6:96708666-96708688 TCAGACAGCTTAAATCAGTGTGG - Intergenic
1012580411 6:100862344-100862366 TTTCACAACTTAAAACAATGAGG + Intronic
1012637092 6:101557517-101557539 TGTTACAGTTTAATAAAGTGGGG + Intronic
1013035517 6:106378626-106378648 TTTCACAGATTAAACAATTGAGG + Intergenic
1013359417 6:109380865-109380887 TCTATCATCTTAAAATAGTGCGG + Intronic
1014114851 6:117659747-117659769 ACTCACTGCTTAAAAAAAAGGGG - Intergenic
1014479142 6:121913623-121913645 TCTCACATGTTTACAAAGTGGGG - Intergenic
1016556575 6:145345486-145345508 TCTCACACATTTAAAAAATGGGG - Intergenic
1020596167 7:10210632-10210654 TTTCATAGCATAAAAAAGAGAGG - Intergenic
1020734610 7:11932107-11932129 CCTCACAGTTTGAGAAAGTGAGG + Intergenic
1023237625 7:38107095-38107117 TCCCACAGATAGAAAAAGTGAGG + Intergenic
1023448131 7:40253147-40253169 TTTCACAGATGAAAAAAGGGAGG - Intronic
1024084524 7:45882384-45882406 TCTTACAGGTGAAAAAACTGAGG + Intergenic
1025216990 7:57065226-57065248 TCTAACATCTTTAAAAAGTTTGG + Intergenic
1025654395 7:63505516-63505538 TCTAACATCTTTAAAAAGTTTGG - Intergenic
1031585838 7:123532072-123532094 TCTTACAGTTGATAAAAGTGTGG + Intronic
1031935985 7:127735985-127736007 TCTCATGGTTTAAAAGAGTGAGG + Intronic
1035001880 7:155619241-155619263 TCTCACTGCTTAAAAGGCTGGGG + Intronic
1036595555 8:10208767-10208789 TCTCTCATCCTAAAAATGTGAGG + Intronic
1037022923 8:13996106-13996128 TCTCACAGATTACAACATTGAGG - Intergenic
1037592245 8:20322856-20322878 TTTTCCAGCTTAAAAAAATGTGG - Intergenic
1038642025 8:29336714-29336736 CCTTACTGCTTAAAAAAATGAGG + Exonic
1038790182 8:30661372-30661394 ACTCACATCTTTAAAAAGTTGGG + Intergenic
1039913432 8:41842581-41842603 TCTCACAGATGAAGAAACTGAGG - Intronic
1041395662 8:57388405-57388427 TCTCACATCCTAAAAGAGAGAGG - Intergenic
1041472254 8:58223861-58223883 TCACAGAGCTTAAAACAATGTGG - Intergenic
1044277187 8:90315277-90315299 ACTGACAGCTTAACAAGGTGTGG + Intergenic
1045534543 8:103014807-103014829 CCTTACAGATTAAAAAACTGAGG + Intergenic
1045907656 8:107367224-107367246 TCTCAGTGCATAAAAAAGTTGGG + Intronic
1047235435 8:123038204-123038226 TTTCACAACTTACAAAAATGGGG - Intronic
1047905678 8:129470744-129470766 TCTCACAGGTGAAAAAACTGAGG + Intergenic
1048029097 8:130614062-130614084 TCTAACCGTTTAAAAATGTGTGG - Intergenic
1048071543 8:131026908-131026930 TTTTACAGCTGAAGAAAGTGAGG + Intronic
1048298266 8:133232144-133232166 TCTCACAGCTGGAGAAACTGAGG - Intergenic
1048706488 8:137159272-137159294 TGTCAGAACTTACAAAAGTGTGG + Intergenic
1049011160 8:139888359-139888381 TCTTACAGATGAAGAAAGTGAGG - Intronic
1051082441 9:13309001-13309023 TCTGATGGCTTAAAAATGTGTGG - Intergenic
1051584029 9:18707705-18707727 TCTAGCTGCTTAAAAAAGTGTGG - Intronic
1051698832 9:19797072-19797094 TCTCAAAAGTTAAAAATGTGAGG - Intergenic
1051988331 9:23118957-23118979 TCTCATGGTTTAAAAATGTGTGG - Intergenic
1052201267 9:25784104-25784126 TTTCACAGATTAAAAAAAGGAGG - Intergenic
1053478712 9:38400532-38400554 TCCCTCACCTGAAAAAAGTGGGG - Intergenic
1054974220 9:71123038-71123060 TCTCACAGATTAAGCAAGTGAGG + Intronic
1058485982 9:105443924-105443946 TTTCACAGCTAAAGAAACTGAGG + Intergenic
1058833840 9:108843141-108843163 TCTGACAGCTTAAAAGCGTGTGG - Intergenic
1059663237 9:116422099-116422121 TTTCACAGATGAGAAAAGTGAGG + Intergenic
1059773225 9:117447628-117447650 TTTCACAGATTAAGAAAATGAGG + Intergenic
1060073661 9:120572721-120572743 TTTTACAGCTAAAGAAAGTGAGG - Intronic
1060651855 9:125334597-125334619 TCTCAAAAATTAACAAAGTGTGG + Intronic
1060746259 9:126133830-126133852 TATCAGAGCTTTAAAAAGGGGGG + Intergenic
1061895642 9:133645840-133645862 TTTCACAGATTAAGAAACTGAGG - Intronic
1185492728 X:531376-531398 TCAGACAGCTTAAAAAAGGAGGG - Intergenic
1187528853 X:20078603-20078625 TTTAACAGCTGAGAAAAGTGAGG - Intronic
1187684105 X:21799316-21799338 TTTCACAGCTGAAAAAACTAAGG + Intergenic
1188527766 X:31104818-31104840 TCTCACAGATGAGAAAACTGAGG + Intronic
1188557414 X:31428280-31428302 TCTGACTGTTTAAAAGAGTGTGG + Intronic
1189564104 X:42221759-42221781 TTTCACAGATGAAAAAACTGAGG + Intergenic
1193248403 X:79258671-79258693 TCTCATAGATCAAAAAATTGAGG + Intergenic
1195277475 X:103296431-103296453 TGTCACAGATTAGAAAAATGAGG + Intergenic
1195393333 X:104385792-104385814 TCTTACAGCTGAGAAAATTGAGG + Intergenic
1196009451 X:110871449-110871471 TCTTATAGCTAAAAAATGTGAGG - Intergenic
1196083221 X:111655625-111655647 TCTTACAGATGAAGAAAGTGAGG - Intergenic
1197445041 X:126543185-126543207 TTTTACAGATTAAAATAGTGAGG + Intergenic
1197552040 X:127902851-127902873 TCTCATGGCCTAAAAATGTGTGG + Intergenic
1199252257 X:145676707-145676729 TATTACAGATTAGAAAAGTGTGG - Intergenic
1200619452 Y:5423586-5423608 TCACTCAGCTTTAAAAAATGAGG + Intronic
1201057242 Y:10007241-10007263 TCTCCCAGTTTATATAAGTGAGG - Intergenic
1202103371 Y:21334548-21334570 TCTCCCAGTTTATATAAGTGAGG + Intergenic