ID: 952647626

View in Genome Browser
Species Human (GRCh38)
Location 3:35680821-35680843
Sequence CACAGCTTAAAAAAGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647624_952647626 14 Left 952647624 3:35680784-35680806 CCTTCTCTTTCTTCTTTTTTTTT 0: 2
1: 77
2: 1677
3: 11924
4: 62044
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226
952647621_952647626 21 Left 952647621 3:35680777-35680799 CCTCCCTCCTTCTCTTTCTTCTT 0: 2
1: 26
2: 289
3: 2356
4: 12158
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226
952647622_952647626 18 Left 952647622 3:35680780-35680802 CCCTCCTTCTCTTTCTTCTTTTT 0: 1
1: 34
2: 313
3: 2487
4: 14473
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226
952647623_952647626 17 Left 952647623 3:35680781-35680803 CCTCCTTCTCTTTCTTCTTTTTT 0: 1
1: 18
2: 299
3: 2637
4: 15715
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226
952647620_952647626 24 Left 952647620 3:35680774-35680796 CCTCCTCCCTCCTTCTCTTTCTT 0: 2
1: 14
2: 131
3: 1068
4: 5718
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226
952647619_952647626 27 Left 952647619 3:35680771-35680793 CCTCCTCCTCCCTCCTTCTCTTT 0: 1
1: 8
2: 115
3: 902
4: 5147
Right 952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647626 Original CRISPR CACAGCTTAAAAAAGTGAGG AGG Intronic
900214941 1:1476402-1476424 GAAGGCTTAAAAAAGTGAGACGG + Intronic
900222152 1:1514756-1514778 GAAGGCTTAAAAAAGTGAGACGG + Intronic
900893902 1:5469630-5469652 CGCAGCTTAAAAAATGTAGGTGG + Intergenic
902595059 1:17503807-17503829 CACAGATAAAGAAATTGAGGCGG - Intergenic
903686293 1:25134799-25134821 CACAGATTAAGAAACTGAGGGGG + Intergenic
904523768 1:31116294-31116316 TAGAGGTTGAAAAAGTGAGGAGG - Intergenic
904684839 1:32252379-32252401 CTCAGAGTTAAAAAGTGAGGAGG - Intronic
904814149 1:33182494-33182516 CACTCCTTAAGAAAGTGAAGAGG - Intergenic
906784146 1:48599547-48599569 TACAGCTTAAGTAAGAGAGGTGG + Intronic
906959136 1:50404970-50404992 AACAGCATCAAAAAGTGAGCAGG + Intergenic
907469177 1:54661511-54661533 CACAGATTATAAAAGTGAACAGG - Intronic
909111712 1:71487143-71487165 TACATCTTAAAAATGTGATGTGG - Intronic
910132456 1:83924742-83924764 CACAATTTAAAAAAGTCAGTTGG + Intronic
913399659 1:118416321-118416343 AACAGTTTAAAAAAATGAGTAGG + Intergenic
914690901 1:150025850-150025872 CACAACTGAAAAAAGAGATGTGG + Intergenic
917037769 1:170767994-170768016 CACGGGATAATAAAGTGAGGAGG - Intergenic
917715239 1:177729003-177729025 TAAAGCTTAAAAAAGTGAAAAGG + Intergenic
918427424 1:184424988-184425010 AACATCTTAAAAAACTTAGGTGG + Intronic
919811870 1:201413813-201413835 CAAAGTTTAAAAAAATGAGATGG - Intronic
919842361 1:201618726-201618748 CACAGGTAAAGAAAATGAGGTGG - Intergenic
920062836 1:203239816-203239838 CTCAGCTTCAAAAAATGTGGGGG - Intronic
921304001 1:213777966-213777988 CACAGCTGAGGAAGGTGAGGTGG + Intergenic
922907413 1:229184914-229184936 TACAGCTGAGAAAACTGAGGTGG + Intergenic
923442603 1:234035550-234035572 CACAGTTTAGAAAAGAGAGATGG - Intronic
924363609 1:243266653-243266675 AACAGCATCAAAAAGTGAGTAGG + Intronic
1068198336 10:53747229-53747251 CACAAATTAAATAAGTAAGGTGG + Intergenic
1070087761 10:73253192-73253214 CACACCTTAAAAAAAAAAGGAGG + Intergenic
1070828699 10:79405763-79405785 CTCAGCTCAAAATAGTGATGGGG + Intronic
1072110133 10:92311415-92311437 CACACCCTAAAAAAAAGAGGTGG - Intronic
1072322626 10:94265560-94265582 AACAGCTTTAAAAAATGATGTGG + Intronic
1072612113 10:97024461-97024483 CACAGCTCAGAAAAGAGAGCAGG + Intronic
1073011595 10:100364236-100364258 GAAAGGTTAAAAAAGCGAGGTGG + Exonic
1073671494 10:105595461-105595483 AACTGCTTAAGGAAGTGAGGAGG - Intergenic
1074542056 10:114373321-114373343 AAAAGTTTAAAAAAGTGGGGAGG - Intronic
1074599835 10:114902272-114902294 CACTGCTTCAGAAAGGGAGGGGG + Intergenic
1075095561 10:119468641-119468663 CACATCTTAGGAGAGTGAGGGGG + Intergenic
1075746428 10:124731343-124731365 CACAGCTCAGAGAAGTGAAGTGG + Intronic
1079572444 11:21961168-21961190 CACAGGTGAAAATACTGAGGTGG - Intergenic
1080476148 11:32593211-32593233 CACAGTTTAAAGAAGTCATGAGG + Intronic
1080688891 11:34538878-34538900 TACAGATAAGAAAAGTGAGGAGG - Intergenic
1084931053 11:72556188-72556210 CACAACTTAGAAAAGTGACACGG + Intergenic
1085076978 11:73599815-73599837 CACAGCTTAAAAAATTGTCCAGG - Intergenic
1088935804 11:114399530-114399552 CATATCTGAAAAAAGTGAAGGGG + Intronic
1090632708 11:128664301-128664323 CTCAGCTTCAGAGAGTGAGGAGG - Intergenic
1090677980 11:129022298-129022320 CATAGCTTAATAAAGTGCAGAGG - Intronic
1091015672 11:132049175-132049197 CACATCTGACAAAAGTGAGACGG + Intronic
1092694554 12:11155275-11155297 CTCTGCTCAAAAAAGAGAGGTGG + Intronic
1096930760 12:55206688-55206710 CACAGATGAAAAAATTGAAGAGG + Intergenic
1099399974 12:82192248-82192270 CACAGCTAGAAAAAGTAGGGGGG + Intergenic
1099942534 12:89205818-89205840 CACAGGTTACAAAAGTGACATGG - Intergenic
1101826058 12:108220984-108221006 CACAGATGAGAAAACTGAGGAGG - Intronic
1105877347 13:24570165-24570187 CACAGCTTAAAAAAATTAAGTGG + Intergenic
1106887038 13:34198383-34198405 CAAAGCTAAAAAAACTGAAGTGG + Intergenic
1111597825 13:90433707-90433729 CACAGCTTAAAAGATTGATGGGG + Intergenic
1112188386 13:97150263-97150285 TTCAGCTCCAAAAAGTGAGGAGG - Intergenic
1112705691 13:102067044-102067066 CATAGTTTTAAGAAGTGAGGTGG - Intronic
1112720397 13:102237275-102237297 AACATCTGAAAAACGTGAGGTGG + Intronic
1113372733 13:109737804-109737826 GACAGCTTAAAGAAGAGAGGAGG + Intergenic
1114141761 14:19920059-19920081 CACACCTTAAAAAAGATGGGAGG - Intergenic
1116665643 14:47771190-47771212 CATATTTTAGAAAAGTGAGGTGG + Intergenic
1116787014 14:49298943-49298965 CACAGCTTAAAAGATGAAGGAGG + Intergenic
1117909945 14:60627305-60627327 CACAGTTTAAAAATGAGATGAGG - Intergenic
1117982663 14:61357284-61357306 CATATGTTAAAAGAGTGAGGCGG - Intronic
1118281265 14:64430897-64430919 CACACCTCAAAACAGCGAGGAGG - Intronic
1118534866 14:66750555-66750577 CTGTGCTTAAAAAAGTGAGGGGG - Intronic
1118885255 14:69860455-69860477 AACAGCTGGAAATAGTGAGGCGG + Intronic
1120221599 14:81740678-81740700 CACAGCTTAAGAAAAGGAGGTGG + Intergenic
1122011646 14:98754066-98754088 CACAGCTAAATACACTGAGGTGG - Intergenic
1123404656 15:20012552-20012574 CACAGCCTTGAAAAGGGAGGGGG + Intergenic
1123505398 15:20938105-20938127 CACAGTTTCAAAGAGTTAGGAGG - Intergenic
1123513989 15:21019199-21019221 CACAGCCTTGAAAAGGGAGGGGG + Intergenic
1123598882 15:21949099-21949121 CACAGTTTCAAAGAGTTAGGAGG - Intergenic
1124636709 15:31369900-31369922 CACAGCTTAATAGAGAGAGGGGG - Intronic
1124943423 15:34239797-34239819 CACAGATTAAATCAGTGATGCGG + Intronic
1125123220 15:36188448-36188470 CACAGCTTGGAATAGTGAGGGGG + Intergenic
1125754232 15:42051552-42051574 CACAGCCTCAGAAAGAGAGGGGG - Intergenic
1126551330 15:49933420-49933442 CACAGCTTCAAAATGTTAAGTGG + Intronic
1126740381 15:51771185-51771207 CACAACTGAATAAAGTGAGCAGG + Intronic
1129537801 15:76328260-76328282 CACAGCTTATAAAAATCAAGAGG - Intergenic
1129921912 15:79326587-79326609 CTCAACTTAAAATAGGGAGGAGG + Intronic
1129966216 15:79738166-79738188 CACAGCTTTAAGAAGTGCGCTGG + Intergenic
1131641175 15:94295415-94295437 CAATGCTTAAAACAGTTAGGTGG - Intronic
1131779403 15:95840490-95840512 CACAGATAAAAAAACTGAGGAGG + Intergenic
1131889370 15:96956005-96956027 CACAGCATCCAAAAATGAGGAGG - Intergenic
1131959612 15:97774682-97774704 AACACCTTAAGAAACTGAGGGGG + Intergenic
1202970987 15_KI270727v1_random:238948-238970 CACAGTTTCAAAGAGTTAGGAGG - Intergenic
1133420156 16:5639062-5639084 CACAGATTAAGAAAATGAGAAGG - Intergenic
1134510357 16:14841749-14841771 AAAAACTTAAAAAACTGAGGGGG - Intronic
1134697998 16:16240238-16240260 AAAAACTTAAAAAACTGAGGGGG - Intronic
1135031408 16:19041722-19041744 CACACCTAATAAAATTGAGGCGG + Intronic
1136040009 16:27571357-27571379 AACAGTTTAAAAAATTAAGGTGG - Intronic
1136181918 16:28559014-28559036 CACACTTTAAAAAAGTGAATTGG + Intronic
1137551074 16:49438006-49438028 CACAGCTCAGAGGAGTGAGGTGG + Intergenic
1137830997 16:51543291-51543313 TACAGCTGTAGAAAGTGAGGGGG - Intergenic
1139831700 16:69803951-69803973 CACAGCTTTAAAAAGTAGGGTGG - Intronic
1140694472 16:77518747-77518769 CACAGCTTAAAAGCATGATGTGG - Intergenic
1140694536 16:77519296-77519318 CACAGCTTAAAAGTGTGATGTGG - Intergenic
1142063804 16:88048626-88048648 CACAGATTAAAGAAAGGAGGTGG + Intronic
1142063815 16:88048746-88048768 CACAGATTAAAGAAAGGAGGTGG + Intronic
1144192958 17:12862837-12862859 TACAGTTTAAAAAAATGAGCTGG + Intronic
1145185335 17:20789027-20789049 GAAAGGTTAAAAAAGTGAGGTGG + Intergenic
1147120833 17:38334241-38334263 CACAGCCAAAGAAAGTGAGCTGG - Intronic
1147919134 17:43905850-43905872 CAGAAATTACAAAAGTGAGGGGG + Intronic
1148725197 17:49784188-49784210 GGCAGCTTACAAAACTGAGGAGG + Intronic
1149533304 17:57412901-57412923 TACAGATAAAGAAAGTGAGGTGG - Intronic
1151653190 17:75482636-75482658 CACAGCTTTTAAAAATGTGGTGG - Intronic
1152106241 17:78330841-78330863 GACGGCTTTAGAAAGTGAGGAGG - Intergenic
1153821521 18:8836384-8836406 CACAGTTTAAAACAGTGAACTGG - Intergenic
1156847528 18:41684483-41684505 TATAGCTTAAAAAAGTGGGTTGG + Intergenic
1158093912 18:53748467-53748489 CAGTGCTTAATAAACTGAGGGGG + Intergenic
1158196301 18:54888936-54888958 CACTGTTTAAAAAAATTAGGAGG - Intronic
1158403836 18:57143873-57143895 CCCAGCTTAAAAAAGGAGGGGGG - Intergenic
1159449448 18:68581576-68581598 CACAGCTTAAACTAGAGAGGAGG - Intergenic
1159592579 18:70351347-70351369 CTCAGGTTAAAAAGCTGAGGTGG + Intronic
1164980680 19:32611440-32611462 CACAGCTGAAAAATGTGTGAGGG + Intronic
1165186004 19:34022020-34022042 CACAGCTTTAAAAAAATAGGGGG - Intergenic
1165938588 19:39403777-39403799 CGCAGCTTAAAGGATTGAGGCGG - Intergenic
1168637081 19:58004581-58004603 CACAGCTTAGAAAACTCAGCAGG + Intronic
925977870 2:9153599-9153621 CACAGCTTAACAAAATGAAATGG - Intergenic
925986792 2:9222909-9222931 CAAAGAGGAAAAAAGTGAGGAGG - Intronic
926796560 2:16624382-16624404 CACATTTTGAAAAAGGGAGGTGG + Intronic
926895590 2:17684072-17684094 CACACCTTCAAAAAGGGAAGGGG + Intronic
926944514 2:18172258-18172280 TACATTTTAAAAAAGTGATGGGG + Intronic
927040933 2:19229521-19229543 CACAGCTTAAAAAATGGACTTGG - Intergenic
929842537 2:45484434-45484456 CACAGCTTACAAATGAGAGTGGG - Intronic
929859067 2:45660243-45660265 TACAGTTGAAAGAAGTGAGGAGG + Intronic
930127027 2:47808266-47808288 CAAATATTAGAAAAGTGAGGGGG + Exonic
932469384 2:71944019-71944041 CACAGCACAGGAAAGTGAGGAGG - Intergenic
932869864 2:75388161-75388183 CAAAGCTTATAAAAGTAAAGAGG - Intergenic
933453245 2:82485389-82485411 CACAGTTTAAAAAAGTGCTCTGG + Intergenic
934927805 2:98393826-98393848 GACATCTTAAAGAAGTGGGGAGG + Intronic
935997742 2:108792720-108792742 CCCAGCTTTAAAAAAGGAGGGGG - Intronic
936729043 2:115358565-115358587 CACAGGTTAAAACAGTCTGGAGG - Intronic
937570898 2:123359824-123359846 CAGAGGTCAAAAAATTGAGGAGG - Intergenic
937626309 2:124047747-124047769 TAGAGCTGAAAAAAGAGAGGAGG - Intronic
941285132 2:163602226-163602248 CACTGCTTTATAAAATGAGGTGG - Intronic
941708006 2:168680321-168680343 CTCAGCTGAAAATAGGGAGGAGG + Intronic
941964931 2:171291575-171291597 AACTGCTTAAACACGTGAGGTGG + Intergenic
942692164 2:178597362-178597384 CATAGAATAAAAAAGTAAGGAGG + Intronic
943629027 2:190230116-190230138 GACAGCTTACAAAAGTGTAGGGG - Intronic
944468881 2:200031899-200031921 CACAGCTAACACAAGTGAAGAGG + Intergenic
944817331 2:203391465-203391487 CACAGCTTAAAAAGGATAGTTGG - Intronic
945922959 2:215774558-215774580 TACAGCTTAAAAATGTGTGTGGG + Intergenic
946680928 2:222215242-222215264 CACAGTTTGAAAAATTAAGGAGG + Intronic
1171048834 20:21836949-21836971 CACAGCAGAAAAAAGGGAGAAGG - Intergenic
1175537828 20:59727439-59727461 CACAGCTTAGAGAAGGGATGGGG + Intronic
1177017470 21:15810135-15810157 CACAGTTTTAAGAAGTGAGTAGG + Intronic
1178540476 21:33445307-33445329 CACAGCTGAAAGAATTGAAGAGG + Intronic
1180578491 22:16804753-16804775 GACAGCTCAAAACAGTGGGGTGG - Intronic
1181019413 22:20091153-20091175 GACAGCTTAAAAAAGTCAGATGG - Intronic
1185243853 22:49762680-49762702 CACATTTAAAAACAGTGAGGTGG + Intergenic
952197957 3:31095842-31095864 CCCAGCTTAAATGAGAGAGGAGG + Intergenic
952647626 3:35680821-35680843 CACAGCTTAAAAAAGTGAGGAGG + Intronic
955055076 3:55447439-55447461 TACAGATAAAGAAAGTGAGGAGG + Intergenic
957852059 3:85820849-85820871 CACAGGTTAAGGAGGTGAGGGGG + Intronic
959077728 3:101767570-101767592 CATAACTTAAAAAAGACAGGAGG - Exonic
959435252 3:106307049-106307071 CTCAGCTTAACAATGTGAGGTGG - Intergenic
959892902 3:111576586-111576608 CACAGCATCAAAAAGCAAGGAGG - Intronic
961676607 3:128571264-128571286 CACAGCCTTAAAAAGGAAGGAGG + Intergenic
963051760 3:141149196-141149218 TACAGCATAATAAAGTGAGAAGG + Intergenic
963600103 3:147371585-147371607 CAAAGCAGAAAAAAGTGAGGAGG + Intergenic
963920927 3:150904483-150904505 CACAGCATAAAATATTAAGGTGG - Intronic
964381553 3:156103058-156103080 CAGAGTTTAAAAAAGGCAGGAGG + Intronic
965342584 3:167508395-167508417 CACAACTTGAAAAACAGAGGCGG - Intronic
966975370 3:185078247-185078269 AACAGCCTTAAAAAGTGAGGTGG + Exonic
967134518 3:186502171-186502193 CACATCTGAAAAAAATGAAGTGG + Intergenic
969071625 4:4544051-4544073 CCCTGCATAATAAAGTGAGGGGG + Intergenic
969690214 4:8700001-8700023 GGCAGCTTCAAACAGTGAGGAGG - Intergenic
969910905 4:10445027-10445049 AACAGCTTAAAAATGTGAAATGG - Exonic
970407859 4:15780805-15780827 AACAGCTAAAAGAAGTGAGTTGG + Intronic
970560890 4:17281363-17281385 CACAGCTTATAAAAAGTAGGGGG - Intergenic
973647684 4:52966463-52966485 CAGAGATTAAAAAGGTGATGTGG - Intronic
973889090 4:55351410-55351432 AACAGCATCAAAAAGTGAGCAGG + Intronic
974139763 4:57870560-57870582 CACAGCTCACAACAGTGAAGAGG + Intergenic
974296913 4:60012321-60012343 CATTGCTTAAAACAGTGAGTGGG + Intergenic
974595719 4:64012594-64012616 CACAGCTAACAAAAGTGTAGTGG - Intergenic
976162370 4:82216988-82217010 CAGAGGTTAAAAAAGTTTGGAGG + Intergenic
978193905 4:105948417-105948439 TACAGATGAAAAAATTGAGGTGG - Intronic
978589214 4:110306105-110306127 TACAGCTTCTAAAAGAGAGGAGG + Intergenic
984267057 4:177508009-177508031 CACAGCTAAAAAAAATCAGGTGG + Intergenic
984901126 4:184587393-184587415 CACAACTTAAATTAGTGAGAAGG + Intergenic
987168339 5:15224737-15224759 CACAGCTTAGAAGAGTGTGGAGG + Intergenic
988928407 5:36012333-36012355 CAGAGGTTGAAAAAGTGTGGAGG + Intergenic
990235639 5:53764701-53764723 CATAACTTAAAAAAGAGAGGTGG + Intergenic
990443956 5:55875811-55875833 CACTGCTTAAAACTTTGAGGAGG + Intronic
991291444 5:65037013-65037035 CCCATCTTAAAAAAGAGAGAGGG - Intergenic
991624183 5:68581530-68581552 TGAAGCTTTAAAAAGTGAGGCGG + Intergenic
992571146 5:78058945-78058967 CACAGGTTCTATAAGTGAGGTGG + Intronic
992939431 5:81749659-81749681 CACAGTTTAAAAAAAAAAGGGGG + Intronic
996677040 5:126188190-126188212 AACAACTCAAAAAAGTGAGATGG - Intergenic
997925902 5:138031382-138031404 CACGGATTAAAAAAGTAAGAAGG + Intronic
998387062 5:141763462-141763484 AACAGCTAGAAAAACTGAGGAGG - Intergenic
998559361 5:143156790-143156812 CACAGCTTATATAGCTGAGGAGG + Intronic
998685825 5:144523391-144523413 CTCAGTTTGAAACAGTGAGGTGG + Intergenic
998726771 5:145026577-145026599 AACAGCTAAAAAATGTGAGATGG + Intergenic
1000166291 5:158652135-158652157 TAAAGCTTAAAAAAGTAAAGGGG - Intergenic
1000558262 5:162753924-162753946 CAGTCATTAAAAAAGTGAGGGGG + Intergenic
1000668369 5:164027515-164027537 CACAGCTGGAAAAGGAGAGGAGG - Intergenic
1004655371 6:17654947-17654969 TACAGATAAAAAAACTGAGGAGG + Intronic
1007030907 6:38625136-38625158 CACATCTGAAAAATGTGAGTTGG - Intronic
1007946772 6:45834057-45834079 TACAGCTCAGAAAAGGGAGGTGG - Intergenic
1008378582 6:50819238-50819260 CAGAGCTTAAAAGGGTGGGGTGG - Intronic
1008832312 6:55780657-55780679 CACAGTTTGATAAAGTGACGGGG + Intronic
1011554432 6:88559868-88559890 CACAGCATTAATAAGGGAGGTGG + Intergenic
1011612062 6:89162062-89162084 TACAGCTTAAATAAGTAAGGAGG + Intronic
1014075265 6:117228184-117228206 CACAGAGAAACAAAGTGAGGAGG - Intergenic
1014114848 6:117659744-117659766 CACTGCTTAAAAAAAAGGGGGGG - Intergenic
1014591478 6:123277144-123277166 CACAGGTTCAAAAAGAGAAGAGG + Intronic
1015721730 6:136249817-136249839 CTCATTTTAAAAGAGTGAGGAGG - Intronic
1019198310 6:170295369-170295391 CACAGCCTGGAAAAGGGAGGGGG + Intronic
1021733833 7:23623260-23623282 AACAGCATCAAAAAGTGAGCAGG - Intronic
1022013564 7:26329715-26329737 CACAGCGTTACAAAGGGAGGAGG + Intronic
1022036469 7:26539230-26539252 TACAGCTTCAAAGAGAGAGGTGG + Intergenic
1023047842 7:36227056-36227078 CCCATCTTAAAGAAGGGAGGGGG + Intronic
1023183992 7:37514558-37514580 GCCAGCTTAAAAAAGTCACGAGG + Intergenic
1024867680 7:53922209-53922231 GACAGTTTAAAAAACTGAGAAGG + Intergenic
1027994535 7:85408705-85408727 TATAGCATAAAAAAATGAGGAGG + Intergenic
1028722332 7:94047924-94047946 CATAAATTAAAAAAGTGTGGTGG + Intergenic
1030435447 7:109513768-109513790 TACAGTATGAAAAAGTGAGGAGG - Intergenic
1030923370 7:115420471-115420493 TAAAGCTTACAAAAGTGTGGGGG + Intergenic
1036592555 8:10182087-10182109 CCCAGCCTCAAAAAGTTAGGAGG - Intronic
1037786854 8:21908503-21908525 CACATCTTCATAAAATGAGGGGG - Intergenic
1038057402 8:23873957-23873979 AACAGCTTAAAATGGGGAGGCGG - Intergenic
1039181443 8:34871322-34871344 CACAGCTTGGAGTAGTGAGGAGG - Intergenic
1039804999 8:40990232-40990254 CACATCTTAAGAAGGTGAGGGGG + Intergenic
1039814337 8:41079610-41079632 CACAGCTTCAAAAAGGGGGAAGG - Intergenic
1041181827 8:55257149-55257171 CACAGCTTCATAATGTAAGGAGG + Intronic
1041389295 8:57334856-57334878 CACAACTTAACAAAGTGAAAGGG + Intergenic
1043729812 8:83662522-83662544 CAAAGCTTAATAAATTGTGGTGG - Intergenic
1047557407 8:125947655-125947677 AATAGCTTAAAAAAAAGAGGAGG + Intergenic
1047624727 8:126644964-126644986 CAGATCTGAAAGAAGTGAGGGGG + Intergenic
1048366697 8:133744694-133744716 CACAGCTGACTAGAGTGAGGAGG + Intergenic
1051155443 9:14139483-14139505 CACAGCTTAAAATAGGGAAGTGG - Intronic
1051326488 9:15976622-15976644 CACAGCTTAAAATAATGATAGGG + Intronic
1053478709 9:38400529-38400551 CTCACCTGAAAAAAGTGGGGTGG - Intergenic
1057742583 9:97724955-97724977 CAGTGCTCAAAAAAGTGATGGGG - Intergenic
1059504685 9:114787652-114787674 CACTGTTTTCAAAAGTGAGGTGG - Exonic
1060245521 9:121942713-121942735 GACAGATTAGAAACGTGAGGAGG - Intronic
1061094601 9:128448239-128448261 CACAGCTTAAGAAAGAAAAGAGG - Intergenic
1186270825 X:7886416-7886438 CTCAGCTTAGAAGAGTGAGTGGG + Intergenic
1190010727 X:46782423-46782445 CACAGATTATAGAAGCGAGGAGG + Intergenic
1194050222 X:89058933-89058955 AAAAGCTTAAAATATTGAGGTGG - Intergenic
1196013922 X:110917427-110917449 CACAACTTAAAACAGTGTAGGGG + Intergenic
1197133157 X:123029488-123029510 AACAGCTTAAAAACCTGAAGTGG + Intergenic
1197827476 X:130605607-130605629 CACAATTTAAAAAGGTGATGAGG - Intergenic
1199185805 X:144913408-144913430 CACAGCTCACAAAATTGACGGGG - Intergenic
1199522404 X:148750751-148750773 CAAAGATTAAAAAAATGAGATGG + Intronic
1200864078 Y:8023923-8023945 CAGGGCTTAAGAAAGAGAGGAGG + Intergenic
1201500343 Y:14635376-14635398 CACTGCTGGAAAAAGTGAGTGGG + Intronic
1201958697 Y:19654128-19654150 AAAAGTTTAAAAAATTGAGGAGG - Intergenic