ID: 952647693

View in Genome Browser
Species Human (GRCh38)
Location 3:35681507-35681529
Sequence GTGTGTAAAGGGGGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952647687_952647693 7 Left 952647687 3:35681477-35681499 CCATTTTGATGGCAAGGTGTATT 0: 1
1: 0
2: 1
3: 11
4: 139
Right 952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG 0: 1
1: 0
2: 5
3: 38
4: 391
952647686_952647693 8 Left 952647686 3:35681476-35681498 CCCATTTTGATGGCAAGGTGTAT 0: 1
1: 0
2: 0
3: 15
4: 125
Right 952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG 0: 1
1: 0
2: 5
3: 38
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952647693 Original CRISPR GTGTGTAAAGGGGGTGTGGA TGG Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
902148194 1:14420884-14420906 GTGTGGAGGGGAGGTGTGGAGGG - Intergenic
902148199 1:14420897-14420919 GTGTGGAGGGGAGGTGTGGAGGG - Intergenic
902818704 1:18930539-18930561 GTATGTCTATGGGGTGTGGACGG - Intronic
903407654 1:23111762-23111784 GTGTGTAAGGTGGGTGGGGAGGG - Intronic
903708794 1:25306525-25306547 GTGTGTGAAAGGGGTGGGTAGGG + Intronic
903718321 1:25385893-25385915 GTGTGTGAAAGGGGTGGGTAGGG - Intronic
903735927 1:25530028-25530050 GTGGGCAGAGGGGGTGTTGAGGG - Intergenic
904912866 1:33948415-33948437 ATATGTAAAGGGGATGTGAATGG - Intronic
905303109 1:36999014-36999036 GTGTGTGTTGGGGGTGGGGAGGG + Intronic
905755465 1:40505621-40505643 ATGTGTGAAGGGGTTGGGGAGGG + Intergenic
906264649 1:44418691-44418713 ATGAGGAAAGGGGGTGGGGAGGG - Intronic
907810318 1:57863266-57863288 GTGTGTATGGGGGATGTGTAAGG + Intronic
908039345 1:60091422-60091444 GAGTGTAAAGGATGTGTGCAGGG + Intergenic
908328894 1:63051078-63051100 GTGTGTACGGGGGTTGGGGACGG + Intergenic
909014883 1:70370609-70370631 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
910118881 1:83762042-83762064 GAGTGAACAGGAGGTGTGGAGGG - Intergenic
910119103 1:83764795-83764817 GTGTGTGAAGGGGCTGAGGATGG + Intergenic
910197633 1:84660290-84660312 CTGAGTAATGGGGGTGAGGAGGG + Intronic
911094257 1:94042920-94042942 GAGAGTTAAGGGGCTGTGGAGGG + Intronic
911158004 1:94655461-94655483 GTGTGCAACTGGGGTGGGGATGG + Intergenic
911587273 1:99705215-99705237 GTGTGGAATGGGGATGTGGCTGG - Intergenic
912439580 1:109688041-109688063 GTGTGTGTTGGGGGTGTGGGCGG + Intronic
913109423 1:115643828-115643850 GTGTGTTAAGGGGATGATGAAGG - Intronic
915245878 1:154556067-154556089 GTGTGTGTAGGGGGTGGGGGTGG - Intronic
915267451 1:154729134-154729156 GTGGGTAGAGGGGGTGTGTGAGG + Intronic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915396606 1:155589993-155590015 GAGTGTAAAGGGGGTGAGGCGGG + Intergenic
915649705 1:157300817-157300839 GAGTGTAAAGGGTGGGAGGAGGG + Intergenic
916445824 1:164870941-164870963 GTGTGAAAAGGGAGTGGGGGTGG - Intronic
916962688 1:169905137-169905159 GTGTGTATGTGGGGTGAGGAAGG - Intergenic
917745607 1:178003829-178003851 GTTTGTGGAGGGAGTGTGGAGGG + Intergenic
918248291 1:182679823-182679845 GTGTGTGTAGGGGGTGCGGGTGG - Intronic
918539354 1:185612106-185612128 GTGTGTAGGGGTGGTGGGGAGGG - Intergenic
919685412 1:200479521-200479543 GTGTGCAGAGGGGCTGGGGAAGG - Intergenic
919925270 1:202188808-202188830 GTACCTAAAGGGGGTGTGGCAGG - Intergenic
920362090 1:205426033-205426055 GTGTGTAAAGCAGGTGAGGGTGG - Intronic
921909646 1:220533277-220533299 GTCTCTAAAGTGGGTGTGCAGGG + Intronic
922057277 1:222053193-222053215 GGCTGCAAAGGAGGTGTGGAAGG + Intergenic
922618662 1:226977810-226977832 GGGTGTGCAGGGGGTGTGTAAGG - Intronic
922618911 1:226978919-226978941 GTGTGTGGTGGGTGTGTGGAGGG - Intronic
922945093 1:229507420-229507442 GTGTGTGTTGGGGGTGGGGAGGG + Intronic
923041791 1:230324927-230324949 GTGTGTTAGGGGTGTGGGGAAGG + Intronic
1063175153 10:3544227-3544249 GTGGGCAGAGGGGGTGGGGAGGG - Intergenic
1063685071 10:8229141-8229163 GTGTGGAAAGGCACTGTGGAAGG + Intergenic
1066142437 10:32519855-32519877 GTGTGAGAAGGAGGTGGGGATGG - Intronic
1066624448 10:37392021-37392043 GTTTGTAATGTGGATGTGGAAGG + Intergenic
1067848800 10:49742460-49742482 GAGTGTATAGGGGGTGTGTGTGG - Intronic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1068577197 10:58697882-58697904 GTCTCTACAGGGGGTGTGGGTGG - Intronic
1068629491 10:59284824-59284846 GTGTGTGAGGTGGGTGTGCATGG - Intronic
1069571151 10:69495154-69495176 GTGTGGAGAGGGGCTCTGGAGGG + Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070587680 10:77779118-77779140 GTGTGTATATGGGGTGGGGGTGG - Intergenic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071676817 10:87662556-87662578 GTGTGTATAGGGGGTGGGGGTGG - Intronic
1073051212 10:100668563-100668585 GTGTGTGGTGGGGGTGTGGGGGG - Intergenic
1073371372 10:102992618-102992640 GTGTGTAAAGGGGGACTGGGAGG + Intronic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1074206278 10:111285768-111285790 GTGTGTAAAGAGGGGTGGGAGGG + Intergenic
1075465524 10:122647730-122647752 GTGTGGAGATGTGGTGTGGATGG - Intergenic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076281408 10:129249661-129249683 GTGTGCATGGGGGGTGTGCATGG + Intergenic
1076281413 10:129249674-129249696 GTGTGCATGGGGGGTGTGCATGG + Intergenic
1076676535 10:132149920-132149942 GTGGGCAGAGGGGGTGGGGAAGG - Intronic
1076930861 10:133530776-133530798 CGGTGTAAAGGGGGTGTGGCTGG + Intronic
1078535291 11:12168416-12168438 GTGTGTATATGGTGTGTGGGGGG - Intronic
1079015077 11:16861993-16862015 CTGAGAAGAGGGGGTGTGGAGGG - Intronic
1079243199 11:18735281-18735303 TTGTGAAGAGGGGGTGTAGAGGG + Intronic
1081231770 11:40593356-40593378 ATGTGTACAGGGAGTGTGTAAGG - Intronic
1081602420 11:44504490-44504512 GTGTGTGAAGAGTGTATGGAGGG - Intergenic
1081979050 11:47254847-47254869 GAGTGGACAGGGGGTGTAGATGG - Intronic
1082197604 11:49323931-49323953 GGTTGTAGAGGGGTTGTGGAGGG + Intergenic
1082808331 11:57463739-57463761 GTGAGAACAGGGGGTGGGGAAGG + Intronic
1083050235 11:59770323-59770345 GTGTGTATATGGGGTGTGGGTGG + Intronic
1084952330 11:72673694-72673716 GTGTGTGAAGGAGGTGGGGAGGG - Intronic
1085198096 11:74684174-74684196 CTGTGTAAAGGAGGGGTTGAAGG + Intergenic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085374954 11:76052038-76052060 TTGTGTAAAGGCCCTGTGGAAGG - Intronic
1085670303 11:78457962-78457984 GTGTGTAACGGGGGCTTGGAAGG + Intronic
1085956634 11:81405711-81405733 GTGTGTAAAGATTGTATGGAGGG - Intergenic
1086658222 11:89384196-89384218 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
1086918147 11:92555061-92555083 GTGTGTATAGTGGGTGTGTGTGG - Intronic
1087401881 11:97677691-97677713 GTGGGTTGAGGGGATGTGGATGG - Intergenic
1087522075 11:99251351-99251373 GTGTGGAAAGTGTGTGTTGAGGG + Intronic
1088682350 11:112254215-112254237 GTGTGAAAAGGGGGTATGTGTGG + Intronic
1089149846 11:116356229-116356251 GTGTGTATTGGGGGTGGGAAAGG - Intergenic
1089309996 11:117551690-117551712 TTGGGGAAAGGGGGTCTGGAGGG + Intronic
1089457514 11:118634181-118634203 GTGGGTACAGAGGGGGTGGACGG - Intronic
1090410234 11:126503181-126503203 GTGTGAAAAGGGAGTGTTGCTGG + Intronic
1091216113 11:133903135-133903157 GTGTGTATACGGGGTGGCGAGGG + Intergenic
1091440238 12:507318-507340 GTGAGTTAAAAGGGTGTGGAAGG - Intronic
1091560000 12:1604985-1605007 GTGTGTGAGGGGTGTGTGTAGGG + Intronic
1092470135 12:8770801-8770823 GTGTCTGAAGGGGGTGAGGTGGG - Intronic
1092570035 12:9711203-9711225 GTGTGAGATGGGGGTGTGGCTGG - Intergenic
1093165697 12:15802832-15802854 GTGTGTAAGGGGGCTGGGCATGG + Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1096079598 12:48824815-48824837 GTGTGGGAAGGGTTTGTGGAGGG + Intronic
1097009208 12:55940499-55940521 GCCTGTAAAGGAGGTGTGGCCGG - Intronic
1097038046 12:56137059-56137081 ATGAGTTGAGGGGGTGTGGAGGG + Intronic
1097832861 12:64243989-64244011 GTGTGTAATGGAGGTGTGAAGGG + Intergenic
1101535269 12:105610706-105610728 GTGTCTACAGGGGGTGGGGCAGG + Intergenic
1102029503 12:109731754-109731776 GTGTGTTCTGGGTGTGTGGAGGG + Intronic
1102438931 12:112946745-112946767 GTGCCTACAGGGGTTGTGGAAGG + Exonic
1102547101 12:113665145-113665167 GTGTGTATAGGGGTTGAGGTAGG - Intergenic
1102547115 12:113665202-113665224 GTGTGTATAGGGGGTGAGGTAGG - Intergenic
1103007513 12:117433499-117433521 GTGTGTAAAGTGTGTGTGTGAGG - Intronic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1103233697 12:119353774-119353796 GTGAGAAAAAGGGGTGTGGCTGG + Intronic
1104072732 12:125360551-125360573 GTGTGCTCAGGGGGTCTGGAAGG + Intronic
1104463695 12:128973896-128973918 GTGTGTAGGGGGTGTGTGTAGGG + Intronic
1104471912 12:129036144-129036166 GTGTGTGAAGGGGGAGTGTCTGG - Intergenic
1104586353 12:130051077-130051099 GAGTGTGAAGGGGCTGTGGAGGG - Intergenic
1104678072 12:130729282-130729304 GGGTGTGACGGGGGTGGGGAGGG + Intergenic
1104910978 12:132240912-132240934 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911064 12:132241182-132241204 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911261 12:132241767-132241789 GTGTGTAATGGGGATAGGGAGGG - Intronic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1106585645 13:31054232-31054254 GTGTGTACAGGGGGTCTGTGTGG - Intergenic
1107127221 13:36858633-36858655 GTGTGTAAGGGTGCTCTGGAAGG - Intronic
1107404158 13:40097360-40097382 GGGAGGAAATGGGGTGTGGAGGG + Intergenic
1112708281 13:102097710-102097732 GTGTGTGAAGGGGGCGAGGTTGG - Intronic
1112832063 13:103465010-103465032 CTGTGTCGAGGGGGTGGGGAAGG + Intergenic
1112845887 13:103643196-103643218 GATTGTAAAGGGTGAGTGGAGGG - Intergenic
1113039186 13:106085701-106085723 GTGTGTGTGGGGGGTGGGGAGGG + Intergenic
1113401279 13:109995896-109995918 GTGTGGGAAAGAGGTGTGGATGG - Intergenic
1113488011 13:110669348-110669370 GGGTGTAGAGGGGGTTTGGGTGG - Intronic
1113526273 13:110980319-110980341 GTGTGTAGAGCTGGTGTGGAAGG - Intergenic
1117473560 14:56071002-56071024 ATATGGAAAGGGGATGTGGAAGG + Intergenic
1117548943 14:56814783-56814805 GTGTGTTAGAAGGGTGTGGACGG + Intergenic
1117627672 14:57656293-57656315 GTGTGTGTGGGGGGTGTGGGGGG - Intronic
1118555830 14:67019981-67020003 GTGTGTACAAGTGGGGTGGAGGG + Intronic
1118709370 14:68507067-68507089 GTATGTGGAGGGGGTGGGGAGGG + Intronic
1118866105 14:69704849-69704871 GTGTGTCCAGGGAGTGGGGAGGG + Intronic
1119470016 14:74890487-74890509 GTGTGGTGAGGGGGTGGGGAGGG + Intronic
1119520935 14:75284608-75284630 GTGAGTAAAAGGGATTTGGAAGG - Intergenic
1120945452 14:89991081-89991103 GTGTGTAAAGGTGAAGTAGAAGG + Intronic
1121661175 14:95636202-95636224 GTGTGTGAAGCGTGTGTGGTGGG + Intergenic
1122657393 14:103271390-103271412 GTGTGTGGGGGGGGTGTGGGGGG - Intergenic
1122692659 14:103538550-103538572 GTGTGGAGTGGGGGAGTGGACGG + Intergenic
1124819946 15:33034798-33034820 GAGGGCACAGGGGGTGTGGAGGG - Intronic
1128227295 15:66011035-66011057 GTGTGTAAAGGGGGTCTGGCAGG + Intronic
1129219899 15:74126082-74126104 GTGTGCAAAGGGGGTGGTGGTGG + Intronic
1130300934 15:82679672-82679694 GTGGGTACATGGGGTGGGGAGGG + Intronic
1131493108 15:92880121-92880143 GAGTGAAAAGGAGCTGTGGAGGG + Intergenic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132711671 16:1271623-1271645 GTGGGTAAAGGGCCTGGGGACGG + Intergenic
1132997377 16:2830271-2830293 GAGTATAAAGGCGATGTGGAGGG + Exonic
1133844837 16:9444082-9444104 GTGTGTGAAGGGAATGAGGAAGG - Intergenic
1134083371 16:11339855-11339877 GTATGCAAAGGGGCAGTGGATGG - Intronic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1138548887 16:57736269-57736291 GGGAGAAAAGGGGGTGTGAACGG + Intronic
1139117353 16:63972872-63972894 GTGTGTAAAATTGGGGTGGAGGG - Intergenic
1139470579 16:67176115-67176137 GTGTGTAATGGGAGTGGGGCTGG + Exonic
1139483838 16:67245453-67245475 GTGTGTCAAGGGGCTGGGCATGG + Intronic
1139963604 16:70732419-70732441 GTGTGCAAGGGAGGTCTGGAAGG - Intronic
1141167226 16:81668829-81668851 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167231 16:81668856-81668878 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167241 16:81668903-81668925 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167252 16:81668950-81668972 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167257 16:81668972-81668994 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167263 16:81668999-81669021 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167275 16:81669049-81669071 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167347 16:81669374-81669396 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167410 16:81669652-81669674 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167434 16:81669756-81669778 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1141217132 16:82035168-82035190 GTGTATGCAGGGGGTGGGGAGGG + Intronic
1142160654 16:88555763-88555785 GTGGGCAGAGGGGGTGGGGATGG - Intergenic
1143149850 17:4801125-4801147 GTGTGTGCTGGGGGTGTAGATGG - Intergenic
1143225517 17:5299118-5299140 GTGTGTGGAGGGGGTGTGGTGGG + Intronic
1143624717 17:8103300-8103322 GTGTGTATACGGGATGTTGAGGG - Intronic
1143635944 17:8163630-8163652 GTGTCTACAGGGTGTGGGGAGGG + Intergenic
1144202892 17:12957060-12957082 GTGGGTAGAGGGGGTGAGGCAGG - Intronic
1144484929 17:15656538-15656560 GTTTGCAAAGGGGCTGGGGAGGG - Intronic
1147042245 17:37727881-37727903 GCGTGGAGAGTGGGTGTGGAGGG + Intronic
1147650736 17:42060450-42060472 GTGTGTGCAGGGAGTGTGCAGGG - Intronic
1147759117 17:42786248-42786270 ATGAGTAAAGGAGGTGGGGAAGG - Intronic
1148021470 17:44556747-44556769 GTTTTTTAAGGGTGTGTGGAGGG + Intergenic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1148799046 17:50211573-50211595 GTGGCTAAAGGGGGTGGGGTGGG - Intergenic
1149458661 17:56809976-56809998 GTGTGTGAAGGGTCTGTGCAAGG - Intronic
1149458698 17:56810176-56810198 GTGTGTGAAGGGTGTGTTCAAGG - Intronic
1149717609 17:58808562-58808584 GGGAGGAAAGGGGGAGTGGAAGG + Intronic
1150109354 17:62484647-62484669 ATTTGAAATGGGGGTGTGGAGGG + Intronic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1150589440 17:66549253-66549275 GTTTGTAAATTGGGTGTGGGTGG + Intronic
1151188745 17:72382360-72382382 GTGTGTTGAGGGGGTGGGGAGGG + Intergenic
1151215087 17:72571722-72571744 GAGTGTCCAGGGGGTGGGGAGGG - Intergenic
1151833332 17:76568658-76568680 GTGTGTAAAAGGGGGAAGGAAGG + Intronic
1151943053 17:77304854-77304876 GTGTGTGAAGGGGGTGCTCATGG + Intronic
1152318009 17:79591910-79591932 ATGTGTGGAGGGTGTGTGGAGGG + Intergenic
1153997301 18:10454153-10454175 GTGTTCAAAGGGGGTGCGGGCGG - Intergenic
1154058912 18:11039923-11039945 GTGTCTATACGGGGTGGGGAGGG - Intronic
1157297259 18:46455328-46455350 GGGTGTTGAGGGGGAGTGGATGG + Intronic
1157306004 18:46518216-46518238 GTGTGGACAGGGGATGTGGTTGG - Exonic
1157505550 18:48223592-48223614 GTGTGTAGGAGGGGTGAGGATGG + Intronic
1158267711 18:55678448-55678470 AAGTGTAAAGAGGGTATGGATGG - Intergenic
1158327111 18:56324204-56324226 GTGTGTGTAGGGGGTGGGGGTGG - Intergenic
1158565475 18:58550916-58550938 GTATGTAATGGAGGTGGGGATGG - Intronic
1158727676 18:59988927-59988949 GTGTGTAATGGAGGTGTTGTAGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1158938015 18:62383048-62383070 GTGTGGAGAGGGGGTGGAGAAGG + Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159653021 18:70999940-70999962 GTGTGAACAGGGGGTGTGGATGG + Intergenic
1159939239 18:74393846-74393868 GTCTGTGAAGGTGGTGGGGATGG + Intergenic
1160032196 18:75271746-75271768 GTGCGTTAAGGGGGTGGGGAGGG - Intronic
1160216341 18:76935736-76935758 GTGCGGTAAGGGTGTGTGGAGGG + Intronic
1160975548 19:1790589-1790611 GTGTGGTAATGGGGAGTGGAGGG - Intronic
1161724549 19:5921007-5921029 GTGTGTGAGGGTGGTGTTGAGGG + Intronic
1162591717 19:11596644-11596666 GTGTGTGACGGGGGTGGGGTGGG - Intronic
1162834662 19:13308370-13308392 ATTTGTACAGGGGGTGGGGATGG - Intronic
1164642845 19:29839047-29839069 GTGTGTATTGGGGGTCTGGGGGG + Intergenic
1164648638 19:29876303-29876325 GAGGGTGAAGGGGGTGTGCAGGG + Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1165239034 19:34448627-34448649 GTGTGTAGAGGGGTTGGGGGAGG + Intronic
1166512332 19:43417448-43417470 ATGTGAAAATGGGGTGGGGAGGG - Intronic
1166881617 19:45933789-45933811 GTGGGGAAAGGGGGTGTGGTGGG + Exonic
1167255223 19:48423606-48423628 GTGTGCAAAGGGCCTGAGGAAGG + Intronic
1168345715 19:55649310-55649332 GTGAGCTGAGGGGGTGTGGAGGG + Intronic
925156373 2:1651573-1651595 GGCTGGAAAGGGGGTGAGGAAGG - Intronic
925160411 2:1679811-1679833 GTGTGTAAATGGTGTGTGTGTGG + Intronic
925160416 2:1679899-1679921 GTGTGTAAATGGTGTGTGTGTGG + Intronic
926166134 2:10522947-10522969 CTGAGTGAAGGCGGTGTGGATGG + Intergenic
926608480 2:14921909-14921931 GTTTGAAAAGGGTGTGGGGATGG - Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927918063 2:26949310-26949332 GTGAGGAAAGGGGGAGTGAAGGG - Exonic
930544143 2:52745816-52745838 CTCTGTAAAGGCAGTGTGGAAGG + Intergenic
932427086 2:71644945-71644967 GTGTGCAGTGGGGGTGTGGCTGG + Intronic
933344148 2:81061972-81061994 TTGTGTGAAGTGGGTGTGGTGGG + Intergenic
933774077 2:85761296-85761318 GTGTGTACAGATGGTGGGGAAGG + Intronic
934779272 2:96959304-96959326 GTGAGTGATGGGTGTGTGGAGGG + Intronic
935116432 2:100140878-100140900 GTGTGTAAAATGGGTTTGGGGGG - Intronic
936412442 2:112272623-112272645 GTGTGGATAGAGGGTGGGGAAGG + Intergenic
937179449 2:119977579-119977601 GTCTCTACAGGGGGTGTGCAGGG - Exonic
937294253 2:120800124-120800146 GTGTGGACAGTGGGTGAGGAGGG + Intronic
938157271 2:128952216-128952238 GAGTGCAGAGGGGGAGTGGAGGG - Intergenic
939779488 2:146427990-146428012 GTGTGAAAAGGAGCTTTGGAGGG + Intergenic
940653328 2:156459257-156459279 GTGGGTTAAGGGGATGTTGATGG + Intronic
941295798 2:163736684-163736706 GTGCGCAGAGGGGGTGGGGAAGG - Intergenic
943688629 2:190845624-190845646 GCGTGTAAATGGGGTATGGCTGG - Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
945239766 2:207665738-207665760 GTGTGAAGAGGGGGAGGGGAAGG + Intergenic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
945442731 2:209899637-209899659 GTGTGTGTAGAGGGTGTGGAAGG - Intronic
946187672 2:217990345-217990367 GTGTGTTGAGGGTGTGTGGCTGG - Intronic
946187690 2:217990445-217990467 GTGTTTGAAGGGTGTGTGGCTGG - Intronic
946894696 2:224311444-224311466 GTGTGTAGCTGGGGTGTGGCTGG - Intergenic
947110669 2:226715831-226715853 GTGTGTGTATGGGGTGTGTATGG + Intergenic
949044322 2:241864091-241864113 GTTTGTTAAGGGGGGGTGGCAGG + Intergenic
949053931 2:241914382-241914404 GTGGAGAAAGGGGGTGTGAAGGG + Intergenic
1168967602 20:1908351-1908373 GTGTGTAGAGGGTGTGTGTGGGG - Intronic
1169797744 20:9482855-9482877 CTGTGTAAAAGGGATTTGGAGGG - Intergenic
1170233129 20:14072254-14072276 GTGTGTGTATGGGGTGTGGTGGG + Intronic
1170428585 20:16258487-16258509 GTGTGTATTTGGGATGTGGAAGG - Intergenic
1172036128 20:32011896-32011918 GTGTGTATTAGGGGTGGGGAGGG - Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1173036654 20:39418125-39418147 GTGTGTGGAGGGGGGGTGTATGG + Intergenic
1173782909 20:45771541-45771563 GCGTGTAAGTGGGGTGAGGAAGG - Intronic
1174527726 20:51187195-51187217 GTGTGTATTGGGGGTGCGAAGGG + Intergenic
1174648619 20:52105869-52105891 GTGTGTGATGGGGGTGGTGAGGG - Intronic
1174947587 20:55005404-55005426 ATGGGTAGAGGTGGTGTGGATGG + Intergenic
1178599767 21:33985579-33985601 GTGTGTACATGGTGTGAGGAGGG - Intergenic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1178900704 21:36596278-36596300 GTGTGTGATGGGGGTGGGGAGGG - Intergenic
1178935289 21:36856570-36856592 GTGTGTTAATTGGGTCTGGAGGG - Intronic
1178968200 21:37144738-37144760 GCGTGTAAGGGAGGTGGGGATGG - Intronic
1179307674 21:40169789-40169811 GTGTGTGAAGGAGGGGTGCAGGG - Intronic
1179998281 21:44984029-44984051 GTGTGTGTAGGGTGTGTGTAGGG - Intergenic
1180084175 21:45500306-45500328 GTGTGTAGTGGGGGTGTGAGGGG + Intronic
1180962883 22:19770293-19770315 TGGTGTGAAGGGGGTGTGGATGG - Intronic
1181118681 22:20650639-20650661 GAGTGTGAAGGGGATGGGGATGG - Intergenic
1181458451 22:23072296-23072318 GGGTGCAGTGGGGGTGTGGATGG + Intronic
1182069716 22:27455019-27455041 GTGGGTCAAGAGGGTGTGGCTGG - Intergenic
1183731781 22:39622413-39622435 GAGTGTAAAGGGCTTGGGGAGGG + Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1185151744 22:49167674-49167696 GAGTGCAGAGGGGGTGTGGAGGG + Intergenic
1185281858 22:49973571-49973593 GTGTGTGTATGGGGTGTGTATGG + Intergenic
949271439 3:2222654-2222676 GTGTGTGTTGGGGGTGTGGGGGG - Intronic
949580836 3:5386036-5386058 CTCTGAAATGGGGGTGTGGAGGG + Intergenic
951685372 3:25338082-25338104 GTGTGTGTTGGGGGTTTGGAGGG - Intronic
952271325 3:31834773-31834795 GTGGGTACAGGGCCTGTGGATGG - Intronic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
954173353 3:48823303-48823325 GTGTCTAAAGGGGGTGTCGGGGG + Intronic
954364538 3:50139039-50139061 GTGTGAATAGGGGGAGGGGAAGG + Intergenic
956350765 3:68333475-68333497 GAGTGTAGAGGGTGGGTGGAGGG + Intronic
958990807 3:100842178-100842200 GTTTGTAGAGAGGATGTGGAAGG - Intronic
959096262 3:101959307-101959329 GTGTGTTTAAGTGGTGTGGACGG + Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
960555426 3:119023542-119023564 ATGTGTAAACTGGGTGTGGGGGG - Intronic
960620509 3:119632410-119632432 GTGAGCAAAGTGGGTGTGGAAGG - Intergenic
961677497 3:128576634-128576656 GTGTACAAAGGGGGAGTGGCAGG + Intergenic
962380327 3:134893487-134893509 GTGAGTGTAGGGGGTGTGGGAGG - Intronic
962596233 3:136947107-136947129 GTGTGGAAGTGGGGTGTGGTGGG + Intronic
962910833 3:139848202-139848224 GTGTGGAAAGGGAGTTTGGCTGG + Intergenic
963475632 3:145800006-145800028 GAGTGTAGTGGGGGTGTGGGAGG - Intergenic
963506328 3:146189593-146189615 GTGTGTAATGAGGGTGGGGAAGG - Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
967495789 3:190143903-190143925 ATCTGTAAAGTGGGTGTGGGAGG - Intergenic
968539146 4:1154236-1154258 GTGTGTGAAGGGAGTCTGGGTGG + Intergenic
968631136 4:1652325-1652347 GTGTGTATAGCGTGTGTGTATGG - Intronic
970250464 4:14110125-14110147 GTGTCTAAATGGGGCATGGAGGG - Intergenic
971735684 4:30447488-30447510 GTGAGTAATAGGGTTGTGGAGGG + Intergenic
972141396 4:35964341-35964363 GTGTGGCAAGGAGATGTGGATGG - Intronic
972406822 4:38754246-38754268 GTGTGTAGAGTGTGTGTGTATGG - Intergenic
972406854 4:38754628-38754650 GTGTGTAGAGAGTGTGTGGAGGG - Intergenic
975547314 4:75573247-75573269 GTGAGTAAAGGCAGAGTGGAAGG - Intergenic
977401271 4:96535235-96535257 GAGAGTGGAGGGGGTGTGGAGGG + Intergenic
977442706 4:97089550-97089572 GTGTGCGTGGGGGGTGTGGAAGG - Intergenic
979131769 4:117056068-117056090 GAGTGTAAAGGGTGTGTAGGTGG - Intergenic
979227282 4:118301507-118301529 GTGTGCATATGGGGTGGGGAGGG - Intronic
979290347 4:118972944-118972966 GTGTGAAAAAGTGGTGTGAATGG - Intronic
979375733 4:119944452-119944474 GGGTGTTCAGGGGCTGTGGAAGG + Intergenic
979928417 4:126597425-126597447 GTGTATAAGGGGTGTGTGAAGGG + Intergenic
980767455 4:137326041-137326063 TTGTGAAAAGGGGGTGAGAAGGG + Intergenic
982440988 4:155435801-155435823 ATGTGAAAAGAGGGTGTTGAAGG - Intergenic
984700036 4:182813276-182813298 GTGTGGTAAGGGTGTGTGTAGGG - Intergenic
985372567 4:189301838-189301860 CTGGGAAAAGGGGGTGTGGTGGG - Intergenic
985677967 5:1242191-1242213 GGGTGCAAAGGGGGTGGGGGTGG - Intronic
987471230 5:18331129-18331151 GTCTGTGGAGGGGGTGTGGAGGG - Intergenic
988098606 5:26649670-26649692 CTGTGTATAGGTGGGGTGGAGGG - Intergenic
990800279 5:59594247-59594269 GTGTGGTAAGGGGCAGTGGAGGG - Intronic
992448524 5:76855169-76855191 GTCTGCAAAGGCAGTGTGGAGGG + Intronic
992515204 5:77484776-77484798 GTCTTGAAAGGGGGTCTGGAAGG - Intronic
992752239 5:79872149-79872171 ATGTGTAAAGGGGGTGCCCAGGG + Intergenic
993833663 5:92789821-92789843 GTGTGTGAAGGGTGAGAGGAGGG - Intergenic
994872322 5:105367512-105367534 GAGTGGAAAGGGTGTGTGGGTGG + Intergenic
995418357 5:111934994-111935016 GTGGGTAGAAGGGGTGTGGAAGG + Intronic
995568954 5:113459173-113459195 GTGTGTGAAGTGGGTGGGGGGGG + Intronic
997243384 5:132325040-132325062 ATGTGTATAGGCGGTGGGGATGG + Intronic
997510471 5:134450388-134450410 GTGTGTAAGGGGGATGTAGTGGG + Intergenic
997956984 5:138286470-138286492 GTGTCTAAATGGGGTCTGGCGGG - Intronic
998153090 5:139768343-139768365 GTGTGTAGTGGGGGAGAGGAGGG + Intergenic
998385850 5:141756743-141756765 GTGTGTGAAGGAGAGGTGGAGGG - Intergenic
1000086577 5:157892759-157892781 CTCTGCAAAGGTGGTGTGGACGG - Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1000805219 5:165782257-165782279 GAGAGTCAAGGGGGTGGGGAAGG - Intergenic
1001332580 5:170772699-170772721 GTGTGTGATGGGTGTGGGGAAGG + Intronic
1002103240 5:176867703-176867725 GTGGGTAAAAGAGGTGAGGAAGG - Intronic
1002862774 6:1094945-1094967 GTGTGTGCCGGGGGTGTGGAGGG - Intergenic
1004819234 6:19348659-19348681 GTCTGGAAAGGAGTTGTGGATGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006109823 6:31737700-31737722 ATGTGTATAGGGGGTGGGGTAGG + Intronic
1007168417 6:39845127-39845149 GTGTGTAATGTGTGTGTAGATGG - Intronic
1009923004 6:70086265-70086287 GTGTGTCAGGGGGGTGGGGCAGG - Intronic
1012443803 6:99288399-99288421 GTGTGTAAGGGTGGTATGGTAGG + Intronic
1012855765 6:104499387-104499409 GTGTGTGCTGGGGGTGTGGGGGG - Intergenic
1013231011 6:108162479-108162501 GTGTGTGGAGGGGGTGTTAATGG + Intronic
1013239815 6:108234078-108234100 GTGTAAAGAGGGGGTGGGGAGGG + Intronic
1013878212 6:114860610-114860632 GTGTGTGGTGGGGGTGTGGAGGG + Intergenic
1015433564 6:133159091-133159113 GTCTGTAAAGGGTGTGTTTAAGG + Intergenic
1017203833 6:151784115-151784137 GTGTGGAAAGGGGGTAAGGAAGG - Intronic
1017258760 6:152363633-152363655 GTGTGATCCGGGGGTGTGGATGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1018935297 6:168270105-168270127 GTGTGTATATGGTGTGTGTATGG - Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1020631266 7:10643087-10643109 GTGTGTAGAGGGGGTGGGGAAGG - Intergenic
1022574821 7:31487446-31487468 ATGTGTATAGGGGGTGGGGAGGG - Intergenic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1023325940 7:39056698-39056720 GTGTGTGTAGGTGGTGGGGATGG + Intronic
1023710399 7:42986488-42986510 GTGTGGAGAGGGGGTGGGGTGGG - Intergenic
1023731845 7:43199076-43199098 GTGTGCAATGAGGGTCTGGAGGG - Intronic
1024647899 7:51384471-51384493 GTGTGTATAGTGGGCCTGGAGGG - Intergenic
1026257356 7:68724021-68724043 GTGTGTTCAGGTGGTGTGGATGG + Intergenic
1026471868 7:70700594-70700616 GAGATTAAGGGGGGTGTGGAGGG + Intronic
1026523714 7:71137016-71137038 GGGTGAAAAGGGGGTGGGGGTGG - Intronic
1027164707 7:75826126-75826148 GTGTGTGTTGGGGGTGGGGATGG - Intergenic
1028420069 7:90622639-90622661 GTGGGTAGTGGGAGTGTGGAAGG + Intronic
1030797483 7:113806581-113806603 GTGGTGAAAGGGGGTGGGGAGGG - Intergenic
1032038375 7:128537163-128537185 ATTTGAAATGGGGGTGTGGAGGG + Intergenic
1032081033 7:128858560-128858582 GTGTGTAATGTGTGTGTGGCTGG - Exonic
1032737758 7:134708588-134708610 GGGTGAAAAGGAGGTGGGGATGG - Intergenic
1033050561 7:138000687-138000709 GTTTGTAATGGGGGTGGGGCTGG - Intronic
1033244074 7:139704078-139704100 TTGGGTATAGCGGGTGTGGAGGG - Intronic
1033249373 7:139745703-139745725 GGGGGTGAGGGGGGTGTGGAAGG - Intronic
1033570942 7:142627538-142627560 GTGTGTGCAGGGGGTGGGGCGGG + Intergenic
1033633479 7:143184883-143184905 GTGTTTAAAAGGCATGTGGAGGG - Intergenic
1033651654 7:143348177-143348199 GTGTTTTGAGGGGGTGGGGAAGG - Intronic
1035407597 7:158609750-158609772 GTGAGTATAGTGGGTGAGGAGGG + Intergenic
1036146526 8:6259302-6259324 GTGTGGAAAGGATCTGTGGAGGG + Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1038864121 8:31420800-31420822 GTGTGTTTTGGGGGTGTGGGCGG - Intergenic
1039403723 8:37294935-37294957 GTGTGGCAAGGGTGTGAGGATGG - Intergenic
1039459047 8:37727922-37727944 ATGTGCTAAGGGGGTGAGGATGG + Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1042794233 8:72643131-72643153 GTGTGGAAAGGGTGTGTGGAAGG - Intronic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1044065870 8:87699643-87699665 GGGTGGAAAAGGGGAGTGGATGG - Intergenic
1044829494 8:96232876-96232898 GTTGGGAAAGGGGGTGTAGAAGG + Intronic
1046718959 8:117597417-117597439 CCCTGTAAAGGGGATGTGGATGG - Intergenic
1047597652 8:126395003-126395025 GTGCTTACAGGGGGAGTGGAAGG - Intergenic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1049172730 8:141171966-141171988 GTGTGAACAGTGGGTGTGCATGG + Intronic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1050388461 9:5113016-5113038 GTGAGTGATGGGGGTGAGGAAGG + Intronic
1051798806 9:20907737-20907759 GTGGGTAAAGAGGGAGTGGCAGG - Intronic
1052220331 9:26014134-26014156 TTGTCTAAAGGGGGAGTGGGTGG + Intergenic
1052883248 9:33618648-33618670 GTGTGTGCAGGGGGTGGGGCAGG + Intergenic
1052991052 9:34519701-34519723 GGCTGTAAAGGGGATGGGGAGGG - Intronic
1053360728 9:37485147-37485169 GGGTGTTGAGGGTGTGTGGAAGG + Intergenic
1053504368 9:38628846-38628868 GTGTGTATGGGGGGTGTTTATGG - Intergenic
1053592216 9:39525976-39525998 GGGTGTAAAGGGAATGTGGCAGG - Intergenic
1053850069 9:42281317-42281339 GGGTGTAAAGGGAATGTGGCAGG - Intergenic
1054574087 9:66839309-66839331 GGGTGTAAAGGGAATGTGGCAGG + Intergenic
1056754249 9:89372274-89372296 GTGTGTGTCGGGGGTGTGTATGG + Intronic
1056831841 9:89923482-89923504 GGTTGTGCAGGGGGTGTGGAGGG + Intergenic
1057075891 9:92137986-92138008 GTACCTAAAGGGGGTGTGGCGGG - Intergenic
1058772391 9:108248256-108248278 GTGTGTGAAGTGGGTTGGGATGG - Intergenic
1058968188 9:110056169-110056191 GTGTGTAGAAGGTGTGAGGAAGG + Intronic
1060602228 9:124885967-124885989 ATGTGTGAAGGGGGTGCTGAAGG + Intronic
1061772358 9:132935702-132935724 GTGAGTCAAGGTGGTGGGGAGGG - Intronic
1062212910 9:135374149-135374171 GTGGGTAGAGGGGGTGTGAGAGG - Intergenic
1062286304 9:135774013-135774035 GTGTGCAAGGGGGGTGTGTCCGG + Intronic
1203445523 Un_GL000219v1:51093-51115 GTGTGTGCAGTGGGTGTGGGGGG - Intergenic
1186034946 X:5411910-5411932 GTGTGTAAATGGGGTATCTATGG + Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186683282 X:11898125-11898147 GTGTGTATTGGGGGTATGGGGGG + Intergenic
1188811189 X:34656446-34656468 TTTTTTAACGGGGGTGTGGAAGG + Intronic
1189267039 X:39725181-39725203 GTGTACAAAGGGGATGTGGGGGG - Intergenic
1190624532 X:52324130-52324152 GTGAGGTAATGGGGTGTGGAAGG - Intergenic
1192790757 X:74379910-74379932 ATGTGTGAAGGGGGTGGGAATGG + Intergenic
1193964428 X:87967522-87967544 GTTTGTAAAGAGGGTGAGGGTGG + Intergenic
1194453614 X:94076054-94076076 GTGAGTAAAGGTGATGGGGATGG + Intergenic
1194592720 X:95819194-95819216 GTGTGTAAATGGGGGATAGATGG - Intergenic
1196523064 X:116696175-116696197 GTGTGTGATGGAGGTGTGGCTGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197903783 X:131401449-131401471 GTGTGTAGGGGGTGTGTGGGAGG - Intergenic
1198155225 X:133953277-133953299 GTGTGTGTAGGGGGTGGGGGTGG - Intronic
1198642358 X:138770447-138770469 GTGAGTCAAGAGGGGGTGGAAGG - Intronic
1202368769 Y:24183660-24183682 GTGAGAAAAGGCGGTGGGGAGGG - Intergenic
1202502016 Y:25486457-25486479 GTGAGAAAAGGCGGTGGGGAGGG + Intergenic