ID: 952651110

View in Genome Browser
Species Human (GRCh38)
Location 3:35727937-35727959
Sequence ACAGTGTGCAGAAGCCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952651110 Original CRISPR ACAGTGTGCAGAAGCCCCTA AGG (reversed) Intronic
900266050 1:1757752-1757774 ACTGTGTGCAGAGGATCCTAGGG - Intronic
900898309 1:5499054-5499076 ACAGTCTGCAGAAGCCATTGGGG + Intergenic
900923521 1:5688974-5688996 TCACTGTGCAGAAGGCCCCACGG - Intergenic
901463201 1:9404095-9404117 ACAGTGTGCATAAGGACCGAGGG + Intergenic
904123894 1:28222752-28222774 ACAGGGTGCTGAAGCCCAAATGG + Intronic
904402495 1:30265978-30266000 CCAGTGTGCAGAGGCCTCTGGGG + Intergenic
904604845 1:31692624-31692646 TCAGTGTGCAGAAGGCCCGAAGG - Exonic
910762737 1:90750787-90750809 ACAGTTTGGAGAAGCACCGACGG + Intergenic
914451985 1:147800642-147800664 ACAGGGAGTAGAAGCCCCTAGGG - Intergenic
915916158 1:159942134-159942156 GCAGTCTGCAGGAGGCCCTAAGG - Intronic
915942521 1:160127794-160127816 ACAGTGGCCAGAAGCCCCTCAGG - Exonic
917074464 1:171189592-171189614 TCATTGTGCAGAAGCAGCTAGGG + Intronic
918048723 1:180956335-180956357 ACAGTGTGGAGCTGCCCTTAGGG + Intergenic
919112962 1:193242447-193242469 AAAGTGAGCAGAAACACCTAAGG - Intronic
1063945031 10:11167703-11167725 ATAGTTTGCAGAAGCCCGTGGGG + Intronic
1064478777 10:15719611-15719633 ACAGTGTACAGCGGCCCCAAGGG - Exonic
1066436522 10:35401030-35401052 AGGGTGTGCAGCAGCACCTAGGG + Intronic
1067384128 10:45803448-45803470 ACAGTGTTCAGAAGCCTCCCTGG - Intergenic
1067698908 10:48554734-48554756 ACTGTGTCCAGAAGCCCCTGTGG + Intronic
1071035477 10:81239170-81239192 ACAGTATGTGGAAGCCACTAAGG + Intergenic
1072875737 10:99171374-99171396 ACAGTCTGGAGAAGCCCTCATGG + Intronic
1078860678 11:15243547-15243569 TCAGTGTGCAGCAGCCTCAAAGG - Intronic
1079605554 11:22360991-22361013 ACTGTGTGCAGATGCAGCTATGG + Intronic
1084303247 11:68264951-68264973 ACTCTGGGCAGAAGCCCCAAGGG + Intronic
1085751221 11:79162795-79162817 GCAGTGTGCAGGAGCCCATTGGG + Intronic
1085999718 11:81967444-81967466 GCAGTGTTCAGAGGCCCATAGGG + Intergenic
1087805412 11:102550248-102550270 AGAGTGAGCAGAAGCCATTATGG + Intergenic
1089621623 11:119725996-119726018 GCAGTGTGGTGAAGCCCCAAAGG - Intronic
1093437253 12:19149803-19149825 CGAGTGAGCAGAAGCACCTAAGG + Intronic
1094012930 12:25828212-25828234 TCAGTGTGCAGAAGCCCTGCAGG + Intergenic
1095637185 12:44448562-44448584 ACAGTGTGGAAATGCCCCTAAGG - Intergenic
1096489556 12:52006415-52006437 TCACTGCGCAGAAGCCCCCAGGG - Intergenic
1096680251 12:53251242-53251264 ACAGTGTGCAAAAGCCCTGGTGG + Intronic
1103010660 12:117455979-117456001 ACAGAGGCCAGAAGCCCATATGG - Exonic
1104115940 12:125749008-125749030 ACACCATGCAGAAGCCACTAAGG - Intergenic
1104647814 12:130509526-130509548 TCAGTGTGCAGCTGCCCTTAGGG - Intronic
1104868365 12:131975352-131975374 ACAGTGTTCCAAAGCCTCTAAGG - Intronic
1108280173 13:48853187-48853209 ACATTCTGCAGCAACCCCTATGG - Intergenic
1116555957 14:46307850-46307872 ACATTGTACAGAATCCTCTAGGG + Intergenic
1124208404 15:27742584-27742606 ACAGTGTGCAGAAAGCTTTAAGG - Intergenic
1129465664 15:75722880-75722902 AGGGTGTCCAGAAGCCCCTGAGG - Intergenic
1139274640 16:65716255-65716277 TCAGTGTGCAGAAGCTGCTATGG - Intergenic
1141349677 16:83282756-83282778 AATGTGTTCAGAAGCCCCTAAGG - Intronic
1141480929 16:84306416-84306438 ACAGTGTGCGGAAGCCTCCAAGG + Intronic
1148482560 17:47969783-47969805 AAAGTGTGCAGAAGGCACTTGGG - Intronic
1152278428 17:79371579-79371601 AGAGTGTCCAGCAGTCCCTAGGG + Intronic
1155036508 18:22029269-22029291 ACAGTTGTCAGAAACCCCTAGGG + Intergenic
1157411487 18:47466608-47466630 ACTGCGTGCAGAAGCTCCTTGGG - Intergenic
1157859180 18:51125478-51125500 ACAGTACGCTGAAACCCCTATGG + Intergenic
1158495503 18:57951722-57951744 AGAGTTTGCAGAAACACCTAAGG - Intergenic
1158931352 18:62326999-62327021 GCACCCTGCAGAAGCCCCTATGG - Intronic
1161737582 19:6001113-6001135 ACAATGTGCAGAAACCCAGAAGG - Intronic
1161767390 19:6215120-6215142 AGGGTGTGCAGAAGCTCCGACGG + Intronic
1163730911 19:18948730-18948752 ACAGAGAGCAGAAGCCCGTGGGG + Intergenic
1165395144 19:35559809-35559831 ACAGTGGCCAGCAGCCCCTCAGG + Exonic
1167361155 19:49031252-49031274 AGAGTGGGCAGAGGTCCCTAAGG + Intronic
1167362495 19:49037545-49037567 AGAGTGGGCAGAGGTCCCTAAGG - Intergenic
1167692125 19:50992137-50992159 ACAGTGTTCAGAATCCCTCAGGG - Intergenic
1168641102 19:58032310-58032332 ACTTTGTGCAGAAACCACTATGG - Intergenic
925390229 2:3489376-3489398 AGAGGGTGCAGCAGCCCTTACGG - Intergenic
925550847 2:5072765-5072787 ACAGGGAGCAGAAGCACCTCAGG + Intergenic
927996345 2:27489505-27489527 ACTGTGTGCAGAAGGCTGTAAGG - Intronic
928105396 2:28467559-28467581 TCAGTGTGCATAAGACCCTTTGG - Intronic
928420663 2:31136062-31136084 ACAGGGAGCAGAACCACCTAGGG + Intronic
929092594 2:38234131-38234153 AAAGTGTGCAAATGCCCCCAGGG - Intergenic
929899718 2:45990259-45990281 ACTGTGTGGAGAGGCCCATACGG - Intronic
930065392 2:47323909-47323931 ACAGTGTGCACAGGCCCCAGGGG - Intergenic
931774907 2:65532278-65532300 ACAGTGATCAGAAGCAGCTATGG - Intergenic
932489463 2:72111227-72111249 TCAGTCTCCAGAAGCCCCTGTGG + Intergenic
935273805 2:101459067-101459089 ACAGTGTAGAGAAGGCCATAAGG - Intronic
937439250 2:121902875-121902897 ACAGTGTGCAGTACTCCCCAAGG + Intergenic
938777186 2:134552301-134552323 ACAGTGTTCTGAAGCACCTGAGG + Intronic
940109730 2:150138290-150138312 ACTGTGTGCAAAAGGCCTTAAGG + Intergenic
947612469 2:231532534-231532556 GCACTGTGCAGAGGGCCCTAGGG + Intergenic
949020831 2:241740463-241740485 ACAGTGTGCAGAAGTGGGTAAGG - Intronic
1169939375 20:10920192-10920214 ACAGTGTGCAGAGATCTCTAGGG + Intergenic
1172017990 20:31890671-31890693 ACAGTGGGCTGAATCCCCCAGGG + Intronic
1172964734 20:38826410-38826432 GCAGTGTGGAGAAGGCCGTAGGG - Intronic
1176707012 21:10124770-10124792 AAAGTGGGCAGAAGCCCATGAGG + Intergenic
1179589532 21:42397371-42397393 GCTGTGTGCAGAAGCCTCTTGGG - Intergenic
1181415114 22:22753712-22753734 ACAGTGTGGAGCAGCCACCAGGG + Intronic
1185348278 22:50320075-50320097 ACAGTGTGCAGAGGCCCTCCTGG - Intronic
950521411 3:13500112-13500134 ACAGTGTGCAGCTGGCCCCATGG - Intronic
952651110 3:35727937-35727959 ACAGTGTGCAGAAGCCCCTAAGG - Intronic
955442207 3:58968686-58968708 TCACTGTGCAGAAGCTCTTAAGG + Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961937905 3:130604967-130604989 ACATTTAGCAGAAGCCACTAGGG - Intronic
962739744 3:138354545-138354567 ACATTGTGGAGAAGCCACTCTGG + Intronic
971292479 4:25357473-25357495 ACACTGTGGAAAAGCCCCTAAGG - Intronic
971849879 4:31970649-31970671 ACAGTGTGCCAGAGCCCATACGG - Intergenic
975924822 4:79436545-79436567 ACATTGTATAGAAGCCACTATGG + Intergenic
980299496 4:130969531-130969553 ACAGTGTTCAGCAGGCCTTAAGG - Intergenic
982959908 4:161823315-161823337 ACAGCCTGCAGACGCCCCTTGGG - Intronic
984038994 4:174705504-174705526 ACAGTGTGCAGAAGACCTTGTGG + Intronic
984305966 4:177991000-177991022 AGAGAGTGGAGAAGGCCCTATGG + Intergenic
984658605 4:182348022-182348044 ACAGTGTGAAGCAGCACCTAAGG + Intronic
985067723 4:186139467-186139489 AAAGGGTGAAGAAGCCCCCAGGG - Intronic
987103690 5:14616293-14616315 TGCGTGTGCAGAAGCCCATATGG - Intergenic
987987041 5:25161288-25161310 ACAGCGTGCAGCAGCCCCGCAGG - Intergenic
990515282 5:56525665-56525687 ACAGTGTGCAGAATCACCTGAGG + Intronic
992993028 5:82304864-82304886 TCAGTTTGAGGAAGCCCCTAGGG + Intronic
997738881 5:136236299-136236321 ACCCTGTGCAGAAGCACCTGAGG - Intronic
999442986 5:151616868-151616890 ACATTGAGCAAAAGCCCCTGAGG - Intergenic
999645660 5:153714699-153714721 AAAGTATGCTGAAACCCCTATGG + Intronic
1003836020 6:10073499-10073521 ACAGGGTTAACAAGCCCCTAGGG + Intronic
1005495954 6:26388108-26388130 ACAGTGTGGAGGGACCCCTACGG + Exonic
1005500651 6:26426337-26426359 ACAGTGTGGAGGGACCCCTACGG + Intergenic
1005505179 6:26463339-26463361 ACAGTGTGGAGGGACCCCTACGG + Exonic
1006800139 6:36754463-36754485 ATGGTGTGCAGAATCCCCTGGGG - Intronic
1010244834 6:73653596-73653618 TCGGTGCGCAGAAGCCCCTCGGG - Intronic
1010953206 6:82061249-82061271 GCACTGTGAAGAAGCCCCCAAGG + Intergenic
1017798766 6:157872663-157872685 GAAGTGTGCAGAAGCCCTTGAGG + Intronic
1019322934 7:423803-423825 ACAGTGAGCAGGAGGCCCTGGGG + Intergenic
1019494640 7:1332107-1332129 AGCGTGTGCAGAAGTCCCTGAGG + Intergenic
1024996398 7:55275977-55275999 ACCCTGTGCAGAAGCCCCCATGG + Intergenic
1026458588 7:70594281-70594303 AGTGTGTGCAGAATCCCCTGGGG + Intronic
1029065825 7:97847310-97847332 ACAATGTGCAGAGCCCCCCATGG + Intergenic
1029640722 7:101817305-101817327 AGAGAGGGCAGAAGCCCCGAGGG - Intronic
1032318791 7:130866012-130866034 ACACTGAGCAGAAGCCCTTGTGG - Intergenic
1034040443 7:147871592-147871614 TCAGTGGGCAGCAGCCCCTGTGG - Intronic
1034954076 7:155322573-155322595 ACTGTGTGGAGATGCCCCTCTGG - Intergenic
1037478052 8:19276955-19276977 CCAGCGTGCAGAAGACCCTGCGG - Intergenic
1045050066 8:98315806-98315828 ACTGGGTGCAGAAGCAGCTATGG - Intergenic
1047935730 8:129776547-129776569 ACAGTGTCCAGAAGACCCCTGGG + Intronic
1053644314 9:40111925-40111947 AAAGTGGGCAGAAGCCCATGAGG + Intergenic
1053761843 9:41353562-41353584 AAAGTGGGCAGAAGCCCATGAGG - Intergenic
1054325163 9:63709168-63709190 AAAGTGGGCAGAAGCCCATGAGG + Intergenic
1054540437 9:66264682-66264704 AAAGTGGGCAGAAGCCCATGAGG - Intergenic
1054926348 9:70592491-70592513 CCTGTTTGCAGTAGCCCCTAAGG + Intronic
1055453145 9:76448899-76448921 ACAGTGAGCAGATGCCCATCAGG - Intronic
1056346641 9:85703087-85703109 ACATTGGGCAGAAGCCACTTGGG - Intronic
1056827726 9:89888393-89888415 CCTGTGTGCAAAAGCCCCGAGGG + Intergenic
1060740610 9:126095505-126095527 GCAGTGTGCAGAGGCCACCACGG - Intergenic
1061522799 9:131130762-131130784 TCAGTGTGCTGGAGCCCCAAAGG + Exonic
1202791757 9_KI270719v1_random:93643-93665 AAAGTGGGCAGAAGCCCATGAGG + Intergenic
1190044598 X:47101731-47101753 ACTTTATGCAGAAGCCCCTGGGG - Intergenic
1193529659 X:82641783-82641805 AAAGTGTGCTCAAGGCCCTAGGG + Intergenic
1194664432 X:96661884-96661906 ACAGTGTGGCGAAGGACCTAAGG + Intergenic
1199289856 X:146093556-146093578 GCAGGGTTCAGCAGCCCCTAGGG + Intergenic