ID: 952651618

View in Genome Browser
Species Human (GRCh38)
Location 3:35734478-35734500
Sequence CAGTGACAAAATCAACTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952651618_952651619 -3 Left 952651618 3:35734478-35734500 CCAAACAGTTGATTTTGTCACTG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 952651619 3:35734498-35734520 CTGTTTTGCAAATATAATTCTGG 0: 1
1: 0
2: 2
3: 37
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952651618 Original CRISPR CAGTGACAAAATCAACTGTT TGG (reversed) Intronic
904731268 1:32593560-32593582 CTGTGACAATCTCAAATGTTTGG - Exonic
908446729 1:64204925-64204947 CAGAAACAATATCAAATGTTAGG - Intronic
910504340 1:87932575-87932597 CAGACACAAACTGAACTGTTGGG - Intergenic
910504423 1:87933645-87933667 CAGACACAAACTGAACTGTTGGG - Intergenic
910534999 1:88287633-88287655 CTGTGACCAAATCAGCTGTGTGG + Intergenic
910903819 1:92151720-92151742 CAGTGAAAAAATGAACTTTGGGG - Intergenic
911600301 1:99841218-99841240 CAGTAACAAAAACTACTGTATGG + Intergenic
912059568 1:105649758-105649780 CAGTGGCAAAATGAAAGGTTTGG + Intergenic
915274754 1:154780743-154780765 CAGTGACGAAATGAACTTCTGGG + Intronic
917552634 1:176050366-176050388 CACTGACAAAATTCACTGCTTGG - Intronic
918577690 1:186082971-186082993 CAGTTCCAAAACCATCTGTTAGG + Intronic
918965404 1:191340688-191340710 CAGGTTCAAAATCAACTGTGTGG - Intergenic
919389697 1:196967009-196967031 CATGGACAAAATCAACACTTAGG + Intergenic
919535862 1:198787076-198787098 CAGAAAGCAAATCAACTGTTGGG + Intergenic
922762388 1:228140994-228141016 CAGGGTCAAAATCAACTTTGAGG - Intronic
923382437 1:233434956-233434978 CAGACCCAAAATCAACTCTTAGG + Intergenic
1064106131 10:12502385-12502407 CAGTGAGAAAATCAGGTGTAGGG + Intronic
1067210245 10:44254814-44254836 CAGTGAGAACATAAAATGTTTGG - Intergenic
1069104601 10:64367885-64367907 CAGTGAAAAAATAATGTGTTTGG - Intergenic
1070636510 10:78132575-78132597 CAGAGACAAACTCATCAGTTAGG - Intergenic
1071273190 10:84027825-84027847 GAATGAGAAAATCACCTGTTAGG + Intergenic
1071711928 10:88058525-88058547 AGGTCACAAAACCAACTGTTTGG - Intergenic
1072699555 10:97630673-97630695 TAGTGACAATATCAACTATTTGG - Intronic
1073166999 10:101464000-101464022 CAGTTACAATTTTAACTGTTTGG + Intronic
1075120713 10:119662632-119662654 CAGTAACAAAGGCAACTCTTAGG - Intronic
1080358693 11:31486555-31486577 CAGTAACAATATTAAATGTTGGG - Intronic
1080963188 11:37184235-37184257 CAATGACAAAATCAGATGTTAGG + Intergenic
1083500510 11:63103245-63103267 CAGGGATAAAATGAACTGGTTGG - Intronic
1085168262 11:74424436-74424458 GACTGACAGAATCAACTTTTTGG + Intergenic
1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG + Intergenic
1088194377 11:107258800-107258822 CAGTAATAAAATCAACATTTTGG - Intergenic
1090742656 11:129679645-129679667 AAGTGAGAAAATCCAGTGTTTGG - Intergenic
1094279069 12:28714930-28714952 CAGTCACAATATGAACTATTAGG + Intergenic
1095260780 12:40096657-40096679 CAGTGATAGATCCAACTGTTTGG - Intronic
1095419097 12:42006601-42006623 CAGTCACAAAGACAGCTGTTTGG + Intergenic
1097330361 12:58326494-58326516 CACTGACAAAATTTTCTGTTGGG + Intergenic
1098200839 12:68053805-68053827 CACTGACAAAACCAAATATTAGG - Intergenic
1100401861 12:94238085-94238107 CAGTAACAAAATCAAGTATATGG + Intronic
1101003766 12:100381826-100381848 CAGTGACAAAATCTAGTATTGGG + Intronic
1107196400 13:37657514-37657536 CAGTGAGAACATAAACTATTTGG - Intronic
1107357019 13:39578313-39578335 CAGTAACATGTTCAACTGTTGGG + Intronic
1109926417 13:69146273-69146295 TAGTGACAACATCAAATGCTGGG + Intergenic
1115982339 14:39067506-39067528 CAAGGACAAATGCAACTGTTAGG - Intronic
1117706894 14:58479175-58479197 CACTGACAACACCAAGTGTTGGG - Intronic
1118441903 14:65820347-65820369 CAGTGAGAAAATCAGCTGTGAGG + Intergenic
1121902861 14:97709733-97709755 CAGTAACAAAACCAACTGATGGG + Intergenic
1123991453 15:25686684-25686706 AAGAGACAAAATAAACTCTTAGG - Intronic
1125268874 15:37915868-37915890 CAGTGAGAACATACACTGTTTGG + Intergenic
1125360648 15:38860957-38860979 CTATGAGAAAATCAACTTTTTGG - Intergenic
1127280672 15:57488796-57488818 ATGTGGCAAAAACAACTGTTTGG + Intronic
1131753256 15:95532665-95532687 CAGTGACAAAATGAACAGTAAGG + Intergenic
1133441179 16:5822191-5822213 CAGTGACAACATAAGATGTTTGG - Intergenic
1134469408 16:14510028-14510050 CAATGGCAAAAACAACTGGTAGG + Intronic
1135233616 16:20734046-20734068 CAGTTACAAAATCCTGTGTTCGG - Exonic
1138054523 16:53818770-53818792 AAGTAACAAACTTAACTGTTTGG - Intronic
1141004252 16:80337387-80337409 CAGTAACAAAATCAATTGACTGG + Intergenic
1141260661 16:82450768-82450790 CAGTAAAAACATCACCTGTTAGG + Intergenic
1146106670 17:30044623-30044645 CACTGACAATACCAAGTGTTGGG + Intronic
1154235993 18:12606289-12606311 CAGTGCCTAAAACAACTGTCTGG + Intronic
1156834768 18:41539355-41539377 TAGTGACAAAATCAACGGCATGG - Intergenic
1157973841 18:52302137-52302159 CAGTGAGAACATCCAATGTTTGG + Intergenic
1158064477 18:53389128-53389150 CACTTACAAAAACACCTGTTAGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158830310 18:61270252-61270274 CAGTGAGAAAATACAGTGTTTGG - Intergenic
1160449754 18:78954446-78954468 CAGTTTCGACATCAACTGTTTGG - Intergenic
1162251430 19:9447176-9447198 CATTGACAAAATAAGCTGTAAGG + Intergenic
1163659501 19:18568365-18568387 AGGTGACAAAACCAACTCTTGGG + Intronic
1165405968 19:35631323-35631345 CAGGGCCAAAGCCAACTGTTGGG - Exonic
924995316 2:355667-355689 CAATGAGAAGGTCAACTGTTAGG + Intergenic
925483849 2:4305895-4305917 GAGTGAGAATATCCACTGTTTGG - Intergenic
926026762 2:9551978-9552000 CAGTGAAAAAATCGTGTGTTAGG + Intronic
928799860 2:35074899-35074921 GAAAGACAACATCAACTGTTTGG + Intergenic
928856374 2:35807656-35807678 CAGTGAGAAAATACAATGTTTGG - Intergenic
931994145 2:67823792-67823814 CAGTGAGAAAATTAACTGGAAGG + Intergenic
933501757 2:83121264-83121286 TAGTGACAATACCAAGTGTTTGG + Intergenic
934152972 2:89166781-89166803 CAGTTACTGAATCAACTGTTTGG + Intergenic
934214267 2:90015150-90015172 CAGTTACTGAATCAACTGTTTGG - Intergenic
934879491 2:97962547-97962569 GACTGACAACATCAAGTGTTGGG + Intronic
938758560 2:134402624-134402646 AAGAGCCAAAATCAACTGTTAGG + Intronic
939098321 2:137863240-137863262 CAGAGATAAAATTACCTGTTTGG - Intergenic
940522233 2:154765628-154765650 CAATAACAAAATTCACTGTTAGG - Intronic
941597353 2:167494628-167494650 TACTCACAAAATCAAATGTTAGG + Intergenic
941715073 2:168755209-168755231 CAGATACAATATCAACTTTTTGG - Intronic
941760258 2:169234379-169234401 GAGTGACAACATGAAGTGTTTGG + Intronic
942653205 2:178190120-178190142 CAGTGAGAAAATCAAAAGTCAGG - Intergenic
944005906 2:194904878-194904900 AAGTGACATAAACAACTGTGTGG - Intergenic
947331620 2:229034952-229034974 CAGTGAGAGAATCAGCTCTTGGG + Intronic
947674792 2:231968393-231968415 CAGTGATAAAAACATCAGTTAGG - Intronic
948825557 2:240572015-240572037 CCATGACCAAATCAACTGCTGGG + Intronic
1170753966 20:19180804-19180826 CAGTGATATAATTAACTTTTAGG - Intergenic
1173224809 20:41156229-41156251 CAGTGACAAGATAAGCTGCTTGG - Intronic
1175090656 20:56500755-56500777 CAATGACAAACTAAACTGCTGGG - Intronic
1178252549 21:31018372-31018394 CATTAACAAAATCAGCTATTGGG + Intergenic
1178594338 21:33939339-33939361 CAGTGAGGAAATCAACAGCTTGG + Intergenic
1182748534 22:32624062-32624084 CCTTGCCAAGATCAACTGTTTGG + Intronic
1185342535 22:50298092-50298114 CAGTGACCAGATCCAGTGTTTGG - Intronic
949722637 3:7008511-7008533 GAGTGAGAAACTCAATTGTTTGG + Intronic
949734712 3:7158540-7158562 CAGTGACAAAATTAAATGTGTGG - Intronic
950753714 3:15154466-15154488 CAATTACAAAAACAGCTGTTGGG + Intergenic
951242611 3:20304584-20304606 AAGATACAAAATCAACTGTCAGG - Intergenic
951764390 3:26181176-26181198 CAGTAAGATAACCAACTGTTGGG - Intergenic
952616000 3:35274812-35274834 CGGTGATAAAATCAACAGTCAGG - Intergenic
952651618 3:35734478-35734500 CAGTGACAAAATCAACTGTTTGG - Intronic
954216896 3:49129644-49129666 CAGTAACAGGATCCACTGTTGGG + Exonic
954824844 3:53363724-53363746 CAGTCACAAAATTAAGAGTTAGG - Intergenic
955791408 3:62592121-62592143 CAGCTACAAAATCCACTGTGGGG - Intronic
957074482 3:75590906-75590928 CAGTGACAGAGACAATTGTTTGG + Intergenic
957115826 3:76024880-76024902 CAGTGACAAACTCACCTTTCTGG + Intronic
957306016 3:78459786-78459808 CAGGAAAAAAATCATCTGTTTGG + Intergenic
957455900 3:80444375-80444397 CAGTAAAAAAATCAAATCTTGGG + Intergenic
957936004 3:86943749-86943771 GAGAGACAAAATAATCTGTTAGG + Exonic
958709215 3:97696839-97696861 CTGTGACAAGACCCACTGTTGGG + Intronic
960019810 3:112936033-112936055 AAGTGAGAAAATGCACTGTTTGG + Intronic
960452773 3:117830874-117830896 CAGTGGCAAAATCTGATGTTAGG + Intergenic
961945125 3:130678764-130678786 CAGTGACAGAACCAGGTGTTAGG - Intergenic
964559874 3:157982432-157982454 TATTAACAAAATCAAATGTTAGG - Intergenic
964904137 3:161697330-161697352 CTGTGAGAAAATGAAATGTTGGG - Intergenic
966778742 3:183565311-183565333 TATTGACAAAATCCACTTTTTGG - Intergenic
969894140 4:10287170-10287192 CTGGGACAAAAGCATCTGTTTGG - Intergenic
970549779 4:17167482-17167504 CATTGACATAATCATTTGTTTGG + Intergenic
971019634 4:22520978-22521000 CAGTGAAAAAATAAAGTGTTCGG - Intergenic
971279348 4:25229735-25229757 CAGTAACAACATCAACTGAAAGG - Intronic
971467824 4:26983361-26983383 CAGTGGCAAAAATAACTTTTAGG - Intronic
972391141 4:38614794-38614816 TAGTGACTAAAGCAACTTTTAGG - Intergenic
973089297 4:46112567-46112589 AAGTGATAGAATCAACTGATAGG + Intronic
973094876 4:46184061-46184083 CAGTGAGAAAATGCAGTGTTTGG - Intergenic
974433653 4:61830603-61830625 CAGTGATAAGACCAACTGTAGGG + Intronic
974486186 4:62509133-62509155 CAGTGAAAAAATAATGTGTTCGG - Intergenic
974990684 4:69084700-69084722 CAGTGAAAACATGAAGTGTTTGG + Intronic
976336949 4:83899768-83899790 GAGTCTCAAAATCAACTGATAGG - Intergenic
976411415 4:84717330-84717352 CAGAAAAAAAATCAACTTTTAGG + Intronic
977033126 4:91913309-91913331 CAGTGACAACTTCTACTTTTTGG - Intergenic
978007374 4:103633643-103633665 CAGTGAGAACATAAAATGTTTGG + Intronic
978990377 4:115074579-115074601 CAGTCACAAAATGAAATATTTGG + Intronic
978993969 4:115126219-115126241 AAATGACAGAATCAAATGTTAGG + Intergenic
979358900 4:119738485-119738507 GAGTCACAAAATGCACTGTTGGG + Intergenic
980550679 4:134329513-134329535 CAGATAGAAAATCAACTATTTGG - Intergenic
980684649 4:136211176-136211198 GAGTGACAACATCCAGTGTTTGG + Intergenic
980812013 4:137895215-137895237 GAGTGAGAAAATGAAGTGTTTGG - Intergenic
980974351 4:139596778-139596800 CAGTGACAAAGCCCTCTGTTTGG + Intronic
981561880 4:146056751-146056773 CTTTGACAAAACCAACTGATTGG + Intergenic
981991154 4:150922525-150922547 CAGTGAGAACATACACTGTTTGG - Intronic
982499627 4:156136883-156136905 AAGAGAAAAAAACAACTGTTAGG + Intergenic
982565859 4:156985712-156985734 AAATGACAAAAACAAATGTTGGG - Intergenic
984258985 4:177421272-177421294 CACTGACAACATCAAATGTTGGG - Intergenic
986252963 5:6077775-6077797 CAGTGGCAAAATTAAATATTGGG - Intergenic
986988621 5:13526328-13526350 CAGTGACATGCTCACCTGTTAGG - Intergenic
987458169 5:18172435-18172457 CAGTGAGAACATAAAATGTTTGG + Intergenic
989559579 5:42835978-42836000 TAGTTACACAATCAACTTTTGGG + Intronic
989709305 5:44378066-44378088 CAGTGAAAAAATCATGTGTTGGG + Intronic
990197230 5:53331927-53331949 CAGTGAAAAAGTTACCTGTTTGG - Intergenic
991204372 5:64033521-64033543 CAGTGACACATTAAGCTGTTGGG - Intergenic
992337165 5:75783735-75783757 GAGTGAGAAAATGCACTGTTTGG - Intergenic
992415320 5:76547092-76547114 CAGTGAAAAATTCAACTGTGAGG - Intronic
993075950 5:83231622-83231644 CAGTGCTAAAATAAACTCTTAGG - Intronic
994141987 5:96351945-96351967 CAGAGACCAAAATAACTGTTGGG + Intergenic
994566597 5:101454431-101454453 CAGTAAAAAAATCAACTTGTTGG - Intergenic
995051333 5:107708196-107708218 AACTGACAACATCAAGTGTTGGG + Intergenic
995098285 5:108266477-108266499 CAGTTATCAAATCAACTGTCAGG + Intronic
995686154 5:114774421-114774443 CAGTGACACAAACACCTGTCTGG + Intergenic
996288474 5:121823695-121823717 CAGTGAGAACATTAAATGTTTGG + Intergenic
998175402 5:139898800-139898822 CACTCAGAAAATCCACTGTTTGG + Intronic
1000089477 5:157917810-157917832 CAGTGGCAAATTAACCTGTTGGG - Intergenic
1004379076 6:15116603-15116625 CAGGAACAAATTCTACTGTTTGG - Intergenic
1008526248 6:52410215-52410237 AAGTTACAAAATCAACCGTCTGG + Intergenic
1009405616 6:63308684-63308706 CATTAACAAAATCAGATGTTTGG - Intronic
1011038945 6:83009462-83009484 CAGTGAAATAATCAAATATTTGG + Intronic
1011203884 6:84870312-84870334 CACTGACAAAACCAAATATTAGG - Intergenic
1013890790 6:115024434-115024456 CAGTGACAATTTCAGGTGTTAGG + Intergenic
1015408937 6:132870081-132870103 CAGTGTCAAAAGCTACTGATAGG - Intergenic
1015525055 6:134168048-134168070 CAGCAGCAACATCAACTGTTTGG + Intergenic
1020386624 7:7612148-7612170 CAGTGAAACAATCATATGTTAGG + Intergenic
1020973679 7:14980068-14980090 TAGTGACAAACTCAATTATTAGG + Intergenic
1021103708 7:16613409-16613431 CAGTAACAAAAGCAACTGGGTGG + Intronic
1027728865 7:81843740-81843762 GAGTGACAACATGAAGTGTTTGG + Intergenic
1027907286 7:84201330-84201352 TAATGGCAAAATCAACTGTTTGG + Intronic
1030438908 7:109560512-109560534 CAATCACAAAACCAACTTTTTGG + Intergenic
1030691320 7:112537784-112537806 CAGTGACAAGAGCATCTCTTTGG + Intergenic
1036241212 8:7082698-7082720 CAGTGACAGAGGCAACTATTTGG - Intergenic
1038059686 8:23899271-23899293 CTGTAACACAAACAACTGTTAGG - Intergenic
1042129127 8:65569523-65569545 CAGCAACAAAATCAAGTGTGAGG + Intergenic
1042154541 8:65828739-65828761 GACTGACAAAATCCACTGTTGGG - Intronic
1043273219 8:78360419-78360441 CAGATACAAAAACAAATGTTGGG - Intergenic
1045130432 8:99145953-99145975 CAGTGACAAAACAAAATGCTGGG - Intronic
1045811544 8:106226017-106226039 CAGTGAGAAAATCCACAATTCGG - Intergenic
1051657238 9:19394804-19394826 CAGTGACAACACCAAATGTGGGG + Intergenic
1053401250 9:37825639-37825661 GAGTGACAAAATAATCTGTACGG + Intronic
1056373019 9:85977746-85977768 CAGTTACATAATTAACTGTTGGG + Intronic
1059955443 9:119510993-119511015 CAGTGACAGCATCAAGTTTTGGG - Intronic
1061485055 9:130916299-130916321 CACTGGCAAAATCAACTGAATGG - Intronic
1186585261 X:10866742-10866764 CAGTAACACAAACAATTGTTTGG + Intergenic
1187614202 X:20975481-20975503 GATTGAGAAAATCATCTGTTTGG - Intergenic
1188254822 X:27948830-27948852 CAGTGACAACATGCAGTGTTTGG + Intergenic
1188613489 X:32128668-32128690 CAGTGTCAAATTCAACATTTAGG + Intronic
1189077821 X:37936690-37936712 CATGGACTATATCAACTGTTGGG - Intronic
1190778422 X:53574007-53574029 CACTGGCAAAATCAAGTCTTAGG + Intronic
1191625923 X:63271451-63271473 CAGAGATAAAAACCACTGTTTGG - Intergenic
1194147784 X:90283635-90283657 CTGTGATAAAAACCACTGTTTGG + Intergenic
1194211497 X:91075198-91075220 GACTGACAATATCAAATGTTGGG + Intergenic
1194917976 X:99728044-99728066 CAGTGAGAACATAAAATGTTTGG - Intergenic
1195099036 X:101536265-101536287 AAGTCACAAAAGCAACTGTGGGG + Intergenic
1196694744 X:118599714-118599736 CAGGGAAAAAACCAAGTGTTAGG - Intronic
1197493007 X:127141932-127141954 GATTGACAATTTCAACTGTTGGG + Intergenic
1198711153 X:139505846-139505868 AAGTGACACAATCAACTGGCAGG - Intergenic
1198754071 X:139964820-139964842 GAGTGAGAAAATGAAGTGTTTGG - Intronic
1201273613 Y:12278982-12279004 GAGTGCCAAAATCAACTCTGAGG - Intergenic