ID: 952653742

View in Genome Browser
Species Human (GRCh38)
Location 3:35758631-35758653
Sequence TGGCAAACAGCAGGGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952653742 Original CRISPR TGGCAAACAGCAGGGCTGAA GGG (reversed) Intronic
900419050 1:2547685-2547707 TGGTACACAGCAGGGCTCACAGG - Intergenic
901148651 1:7085753-7085775 TGGGAGCCAGCAGGGCTGGAGGG - Intronic
901713067 1:11130816-11130838 TGACCAACAGCAGGGCTCAGAGG + Intronic
901908825 1:12437818-12437840 GGGAAAACATCAGGGCTCAAAGG - Intronic
904461737 1:30684778-30684800 TGGCACACAGCAGGGCAGCATGG + Intergenic
904943226 1:34179324-34179346 TGGCAATGAGCAGGGGAGAAGGG - Intronic
905738780 1:40351210-40351232 TGACAGAGAGCAGGGCTGAGAGG + Intronic
905895128 1:41540784-41540806 TGGAAAAAAGCAAGCCTGAATGG + Intronic
906754469 1:48296446-48296468 CTGCAAAAAGTAGGGCTGAAAGG - Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907972418 1:59396459-59396481 TCTGAGACAGCAGGGCTGAATGG - Intronic
908776466 1:67645755-67645777 AGGCAAACAGAAGGGATCAAAGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
912859279 1:113198534-113198556 TGGCAGTCAGTAGGGCTGAGTGG - Intergenic
914907046 1:151755151-151755173 TGGGAACAAGCAGGGCTGGAAGG + Intergenic
917315812 1:173724221-173724243 TGGCAAACTCCTGGGCTTAAGGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919669372 1:200324952-200324974 AGGCAAACAACAGGATTGAATGG - Intergenic
919744235 1:200998928-200998950 TGGCAGCAGGCAGGGCTGAAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920876290 1:209839253-209839275 TGGCAAACAACATGTCTCAAAGG - Intronic
921712148 1:218383649-218383671 TCACAAACAGTATGGCTGAAGGG - Intronic
922543656 1:226437716-226437738 TGGAAAAGAGGAGGGCTGAAGGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062797700 10:357181-357203 TGGGAAACAGGAAGGCCGAACGG + Intronic
1063531828 10:6840525-6840547 TGGGAAGGAGCAGGGCTGCAGGG - Intergenic
1063631915 10:7741969-7741991 AGGCAAACAGCAAGGCTGAATGG - Intronic
1063739172 10:8797926-8797948 GGGCACACAGTAGGGCTGAAAGG + Intergenic
1064133984 10:12734817-12734839 TTGCAAACAGCAGGCCTGAAAGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065920628 10:30389349-30389371 TGGAAAATAACAGGGCTGATAGG + Intergenic
1066209638 10:33224234-33224256 TGGCACACAGAAGGGCTTCAAGG - Intronic
1066244767 10:33571710-33571732 AGGCAAAGAGCAGGGGTGAGGGG - Intergenic
1066501744 10:36001538-36001560 TGGGCATCAGTAGGGCTGAAGGG - Intergenic
1068037946 10:51784248-51784270 TGGCATAAAGAAGAGCTGAAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069460304 10:68588901-68588923 TCTCAAACACCAGGGCTCAAGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073852351 10:107635526-107635548 TGGCACAGAGCTGGGCTTAAAGG - Intergenic
1074011113 10:109481033-109481055 TGGGAAACAGCTGGGCTTACTGG - Intergenic
1074030923 10:109687324-109687346 TAGCAAAGAGCAGGGCTCCATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076939215 10:133590549-133590571 TGTCACACAGCAGGGCTGGGTGG - Intergenic
1077361602 11:2143217-2143239 TGACACTCAGCAGGGCTGGAAGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080183765 11:29454763-29454785 TGTCAAACAGCAGTACTGCAAGG - Intergenic
1082839769 11:57679486-57679508 TTGAAAACAGGAGTGCTGAATGG + Intronic
1083362919 11:62123901-62123923 TGGCCAATAGGAGGGCTGACTGG + Intergenic
1084188220 11:67486550-67486572 TGGGAAACAGCAGGGCAAGAGGG - Intronic
1084658195 11:70531557-70531579 TGGCATGCAGCAGGGCTGTGAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084896835 11:72277982-72278004 TGGCAAAGAGCTGGGCGCAATGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085777952 11:79383071-79383093 GGGCACAGAGCAGGGCAGAAAGG - Intronic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1086815930 11:91370626-91370648 TGGCAAAGAGCATGGATAAAGGG + Intergenic
1088199265 11:107313347-107313369 AGGTTAACATCAGGGCTGAAGGG + Intergenic
1088767153 11:112993573-112993595 TGACAAAAAGGAGAGCTGAAGGG - Intronic
1089440296 11:118510379-118510401 TGGCAAAAAACAAGGCTGGAGGG - Intronic
1090174616 11:124637517-124637539 TGCCAAACAGCAAGGCAGACAGG + Intronic
1090319257 11:125827870-125827892 GGGTAAACAGAAGGGATGAAGGG + Intergenic
1091220816 11:133929035-133929057 TGGCAAACACCAGGTCTTACTGG - Intronic
1092972110 12:13706257-13706279 TGGAAAACAGCAGGGATTAGTGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093394076 12:18659074-18659096 TAGGAAACAGTAGGGCAGAAGGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096520797 12:52183520-52183542 GGGCAAACAGCCTGGCTGGAGGG - Intronic
1096817152 12:54208818-54208840 TGGCACCCAGCAGGGTTCAAAGG - Intergenic
1097261573 12:57723486-57723508 TGGCAGCCAGCAGGGCTGCAGGG + Intergenic
1102923283 12:116808748-116808770 TGGCAAACGGCAGGGAGGAGGGG + Intronic
1103516496 12:121511843-121511865 TGGCACACAGCAGCTCTGGATGG + Intronic
1104233297 12:126906559-126906581 TGGCACACAGGGAGGCTGAAAGG + Intergenic
1105261729 13:18784589-18784611 TAGCAAAGAACATGGCTGAAGGG - Intergenic
1105264084 13:18801174-18801196 TAGCAAAGAACACGGCTGAAGGG - Intergenic
1107155825 13:37166147-37166169 TGACAGACAGCAGGCCTAAAAGG + Intergenic
1107334170 13:39335486-39335508 TGACAAACAGCAGGTCTTTAAGG - Intergenic
1108212515 13:48152571-48152593 TCATAAACTGCAGGGCTGAATGG - Intergenic
1108613684 13:52109413-52109435 TGACAGATAGCAGGCCTGAAAGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108961154 13:56232031-56232053 TGGCCAACATCCTGGCTGAAAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111674418 13:91369131-91369153 TGGCAATCAGCAGCACTGAGAGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114445352 14:22783981-22784003 TGGCAGGCAGCAGTGCTGACAGG + Intronic
1115019433 14:28658045-28658067 TGGAAAACAGAATGGCTGTATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115525351 14:34274716-34274738 CGGCAAACAGCGGGACTGATGGG - Intronic
1115749685 14:36477009-36477031 TGGGATGCAGCAGGGCTGTATGG + Exonic
1116438604 14:44923585-44923607 TGGCAAATTACAGGCCTGAATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118440351 14:65806276-65806298 TGGCAACAAGCAGGGTAGAAAGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120916720 14:89716990-89717012 GGACAAACAGCAGGTCTGATGGG - Intergenic
1121404669 14:93712524-93712546 GGGCAGACAGCATGGCTGAGTGG - Intergenic
1122367574 14:101203198-101203220 TGGCCAACTGCAGTGCTGATGGG - Intergenic
1122535593 14:102459809-102459831 AAGAAAACACCAGGGCTGAAGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123458756 15:20448812-20448834 GGGCCAAAAGCAGGGCTAAAAGG + Intergenic
1123659306 15:22551604-22551626 GGGCCAAAAGCAGGGCTAAAAGG - Intergenic
1123876144 15:24625982-24626004 TCCCAAACAGCAGGGGTCAAGGG + Intergenic
1124313170 15:28646095-28646117 GGGCCAAAAGCAGGGCTAAAAGG - Intergenic
1124898667 15:33801539-33801561 TGACAGACAGCAGGCCTGGAAGG - Intronic
1124992176 15:34686003-34686025 TGCCCAACAGCAGTGCTAAAAGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127515463 15:59689205-59689227 TCGCAAAAAGCAGGGCCGAGCGG + Exonic
1127818798 15:62637361-62637383 AGGAAAATAGCAGGACTGAAAGG + Exonic
1127930889 15:63596781-63596803 TGGCAGGCAGCAGGGCTTGAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128980392 15:72181178-72181200 TGGTAAACAACAAGGCTGGAGGG + Intronic
1129605572 15:77023398-77023420 GGGCAGAGAGCAGGGCTGACAGG + Intronic
1129652001 15:77497560-77497582 TGGCAGGCAGCAGGGCAGAGGGG - Intergenic
1129696669 15:77744135-77744157 TGGCAGACACCAGGGCTGCCTGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130095255 15:80850906-80850928 TGGCTGAAAGCAGGGCTGCAGGG + Intronic
1131568268 15:93506073-93506095 TGCCAAATGGCAGGACTGAAAGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133389132 16:5395071-5395093 TGGCAAACCACAAGGCTGAACGG - Intergenic
1134021002 16:10921711-10921733 AGGAAAACAGCAGGACTAAAAGG - Intronic
1135185393 16:20311145-20311167 TGGAAAGCAGAAGTGCTGAAGGG + Exonic
1136008172 16:27345231-27345253 GTGGAAACAGCTGGGCTGAAGGG - Intronic
1137815746 16:51395978-51396000 TGGAATACAGCAGGTCTGAGTGG + Intergenic
1137858292 16:51819016-51819038 TGGGAAACAGCAGAATTGAAAGG - Intergenic
1139803118 16:69540591-69540613 TGGGTAACAGCAGGTGTGAATGG - Intergenic
1139962031 16:70723697-70723719 AGGCAACCAGCAGGGCTGGTAGG - Intronic
1143179780 17:4977288-4977310 TGGCCCACAGCAGGGCAGTAGGG - Intronic
1144201886 17:12949259-12949281 TGGCACACAGGAGCGCTGAGAGG - Intronic
1144301027 17:13923175-13923197 TGGCACCCCACAGGGCTGAAGGG + Intergenic
1144587135 17:16493633-16493655 AGGGAAACATCAGGGCTGAGGGG + Intergenic
1145006784 17:19342860-19342882 TGGCCAGAAGCATGGCTGAACGG + Intronic
1147456945 17:40543726-40543748 TGGGAAACAGCCGGGCTGGTTGG - Intergenic
1147649109 17:42051824-42051846 TGGCACAGAGCAGTGCTGCATGG - Intronic
1147667434 17:42157534-42157556 TGGCAATCAGCTGGGCTGGGTGG - Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149302277 17:55316545-55316567 AGGAAAACATCAGGGCTGAAGGG + Intronic
1149570008 17:57665669-57665691 TGGCACACCCTAGGGCTGAACGG - Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1151934621 17:77254396-77254418 TGGGAAACAGAAAAGCTGAAGGG + Intergenic
1152384756 17:79965636-79965658 TGGCCCACAGCAGGGCAGGATGG + Intronic
1152472592 17:80498724-80498746 TGGCCAAGAGCAGGGCGGGAGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154052147 18:10971127-10971149 TGGCAAACAGCAGAGGATAAGGG + Intronic
1154275325 18:12954324-12954346 TGGCCAACAGGAGGGGTGTAAGG + Intronic
1155353807 18:24931471-24931493 AGGCAAAGAGCATGGCAGAAGGG - Intergenic
1155983979 18:32210124-32210146 GCCCAAACAGCAGGGCTAAAAGG - Intronic
1156027028 18:32666969-32666991 CTGCAAACTGCAGGGCTGACTGG - Intergenic
1156717478 18:40028355-40028377 TGAGAAACAGCAGGGCTTCAGGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157979453 18:52363932-52363954 TGGCAGACTGAAGGGCTAAAGGG - Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158667983 18:59449946-59449968 TGCCACACAGAGGGGCTGAAGGG - Intronic
1158902333 18:61975698-61975720 TGGTTAACAGCAGGGATGCAGGG + Intergenic
1159856568 18:73596459-73596481 AGGCACAGAGCAGGGCAGAAAGG + Intergenic
1161663514 19:5561233-5561255 AGTCACACAGCAGAGCTGAAAGG + Intergenic
1161676254 19:5651705-5651727 TGGGAAACACCAGGGAGGAAGGG - Intronic
1163369379 19:16893509-16893531 TGGCAGAGATCAGGGCTGAGCGG + Intronic
1163548958 19:17954612-17954634 TGGTCACCAGCAGGACTGAAGGG + Exonic
1164810432 19:31150684-31150706 TACCAAACAGCAGGGCCCAATGG - Intergenic
1164872736 19:31659732-31659754 TGTCAAACAGGAGGGCTGAGTGG + Intergenic
1164964088 19:32465586-32465608 TGGCTAAAAGCAGGGGTGATGGG + Intronic
1165319139 19:35075095-35075117 TGGCCACCAGCAGGGCGCAAGGG - Intergenic
1166121003 19:40686874-40686896 TGGGACAGGGCAGGGCTGAATGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925178756 2:1802964-1802986 TTGCAGACAGAAGGGCAGAAGGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927882329 2:26697560-26697582 TGGCAAGCAGCAGGCCTGACTGG - Intronic
928298237 2:30103996-30104018 TGGCAAACAGTAGTGATGACCGG - Intergenic
928713850 2:34037426-34037448 TAGCAAACAGCAGAGTTCAATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930738939 2:54809507-54809529 TGACTAACAGCATGGCTGGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933711751 2:85331533-85331555 TGGCATACAGCAGGGCGCAGTGG - Intergenic
933940173 2:87238683-87238705 CTGCAACCAGCAGGGGTGAAAGG - Intergenic
933993013 2:87647166-87647188 TGGCACCCAGCAGGTCTGCAAGG + Intergenic
935211770 2:100944883-100944905 TGGCAGAGAGCAAGGCTGAGTGG - Intronic
936300844 2:111303713-111303735 TGGCACCCAGCAGGTCTGCAAGG - Intergenic
936344325 2:111663517-111663539 TGGAAAACAGACGGGGTGAAGGG + Intergenic
936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937249409 2:120514112-120514134 TGGCTAACAGCATGGCTGAAGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939260281 2:139799086-139799108 TGGATAACAGCAGGGCTGCCTGG + Intergenic
939526105 2:143296305-143296327 TGGCACAGAGAAGAGCTGAAAGG + Intronic
939811030 2:146832452-146832474 TTGCAAGCAGCTGGGCTGACAGG + Intergenic
940271902 2:151900073-151900095 TGGCAGACAGCAAAGCTAAAGGG + Intronic
940415969 2:153420639-153420661 TGACATGCTGCAGGGCTGAAAGG + Intergenic
940460373 2:153957313-153957335 TAGCAAACAGCATTGCTCAAGGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941008970 2:160276959-160276981 TTGCAAACTCCAGGGCTCAAGGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943810422 2:192180800-192180822 TGACAAACAGGAGGGCTGCTGGG - Intronic
944992606 2:205255022-205255044 TGGCAAAAGGCAAGGCTGGAAGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
947496846 2:230643908-230643930 TGTCAAACAGCAGGTTTGAGTGG + Intergenic
948815768 2:240509794-240509816 TGGCATACAGCAGGTGTGACTGG + Intronic
1168811755 20:709424-709446 TGGAAAACAGCACGGTGGAAAGG - Intergenic
1169509622 20:6249634-6249656 TGGGAAGCACCAGGGCTGATCGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172234471 20:33361172-33361194 TGGCAGAAAGCAGGGGTGATTGG - Intronic
1172613660 20:36269184-36269206 TGGCAGAGAGCAGGCCTGCAGGG + Intronic
1172636287 20:36412168-36412190 TGGCAAACAGCAGAACAAAATGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173452994 20:43181691-43181713 TGGCATACAGCAGGGTAAAATGG - Intronic
1174125208 20:48299229-48299251 TGACAAACAGCAGGGCACCATGG + Intergenic
1175297547 20:57919448-57919470 TGTCATACAGCAGGGCTGGGAGG - Intergenic
1175741531 20:61423032-61423054 TCGCAAACAGGATGGCTGAGTGG + Intronic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177638409 21:23815556-23815578 TGGCCAGCAGCAGGGGTGACAGG + Intergenic
1177640203 21:23835277-23835299 TGGAACACAGCAGGTCTGAGTGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179311850 21:40203139-40203161 TGGGAAACAGATGGGCTGCATGG - Intronic
1179458315 21:41515041-41515063 GGCCAAACAGGAGGGTTGAATGG + Intronic
1179511016 21:41873596-41873618 AAGAAAACAGTAGGGCTGAAGGG - Intronic
1180228985 21:46414904-46414926 TAGCAAACAGCAGGGAGGAGGGG - Intronic
1181089709 22:20464261-20464283 TGGCAGACTGCAGGGCAGAGCGG + Intronic
1184478476 22:44734322-44734344 TGGAAGACAGCAGGCCTCAAGGG - Intronic
1184621431 22:45681746-45681768 GGGCAAACAGCGGGACTGACAGG - Intronic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
950335362 3:12188800-12188822 CAGGAAACAGCTGGGCTGAAGGG - Intronic
950447250 3:13045440-13045462 GGGGAAACAGCAGAGCTGAGGGG + Intronic
950467532 3:13163957-13163979 GGGCACACGCCAGGGCTGAAGGG + Intergenic
950529317 3:13544040-13544062 TGGCAAACACCAGTGTTCAAAGG + Intergenic
950638607 3:14333434-14333456 TGGGGAACATCAGGGCTGAAAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
952114201 3:30159669-30159691 TGGCCAATGGCAGGGCTGAGGGG - Intergenic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
953397646 3:42585840-42585862 TGGCAAATAGGAGCGCTGAAAGG - Intronic
954233188 3:49234697-49234719 AGGAACAGAGCAGGGCTGAAGGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955594577 3:60574774-60574796 TGGCAAGCGGAAGGACTGAAAGG - Intronic
957280295 3:78142881-78142903 TGGCTAACAGCAGGGTTGGCTGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960501583 3:118444858-118444880 CTGCAGACAGCAGAGCTGAAAGG - Intergenic
961517626 3:127448018-127448040 TGGCATACTGAAGAGCTGAAAGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
967183901 3:186929775-186929797 TGCCCAACAGGAGGGCGGAAGGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969534770 4:7748969-7748991 TGGAAAACACCTGGTCTGAAGGG + Intergenic
971244680 4:24917274-24917296 TGGCAGCCAGCGGGGCTGGAGGG - Intronic
971767648 4:30853936-30853958 TGCCACACAGCAGGGCTGCATGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
972908809 4:43787149-43787171 TGGCAAACAGTAGGAATAAAAGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975430402 4:74283590-74283612 TGCCAAACAGTAGAGCTGAATGG - Intronic
975476983 4:74834722-74834744 TGGTAAGCATCAGAGCTGAAAGG - Intergenic
976684099 4:87791577-87791599 TGAAAAACAGAAGGGCTGTATGG + Intergenic
977181169 4:93876400-93876422 TGTCAAACAGCAGGGATGAGGGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978611579 4:110546504-110546526 TGGCAAAGAGAACAGCTGAAAGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980257380 4:130399843-130399865 TAGCCAAAAGCAGAGCTGAACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981143709 4:141300878-141300900 TTGAAAACAGCAGGGTGGAATGG + Intergenic
981375150 4:144006560-144006582 TGGCATACAGCAAAACTGAAGGG - Intronic
981698722 4:147584734-147584756 TGGCAAAGAACTTGGCTGAATGG - Intergenic
982336473 4:154244892-154244914 GGGCAAGCAGCAGGGGAGAAAGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983918178 4:173314803-173314825 AGGCATACAGCGGGGCTGCAGGG - Intronic
984656543 4:182324714-182324736 AGGCAAACAGCAGGACTGCTTGG - Intronic
986048301 5:4062584-4062606 TTGGCAACAGCATGGCTGAAAGG + Intergenic
986299121 5:6464636-6464658 TGGCAGCCAGCAGGCCTGAAAGG + Intronic
986880241 5:12160984-12161006 TGGCAAATAACTTGGCTGAACGG + Intergenic
986955738 5:13147631-13147653 TGGCACACAACAGGGTTCAAGGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988225798 5:28410295-28410317 GGGCAAACAGCATTGCTCAAGGG + Intergenic
988225999 5:28412048-28412070 TGGCAAACAGCATTGCCCAAGGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989310960 5:40017648-40017670 TGGCAAAGACCTTGGCTGAATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989730502 5:44642016-44642038 AGGCCAGAAGCAGGGCTGAAGGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992036342 5:72782219-72782241 TGGCAAAGAACGTGGCTGAACGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994533832 5:101001898-101001920 TGTCAAAAGGCAGGGTTGAAGGG + Intergenic
994948132 5:106423085-106423107 TGCCAAACAGCAGGCATGAAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997214319 5:132097634-132097656 TAGAAAACATCATGGCTGAAAGG + Intergenic
997400784 5:133600142-133600164 TGACAAACAGAAGGGATGTATGG - Intronic
997424868 5:133796305-133796327 CCGCAGACAGCAAGGCTGAAAGG - Intergenic
999078228 5:148817722-148817744 GGTCAAGGAGCAGGGCTGAAGGG - Intergenic
999252508 5:150190884-150190906 TGCCCCTCAGCAGGGCTGAAGGG + Intronic
1001125722 5:169017548-169017570 TCGCTGGCAGCAGGGCTGAAAGG + Intronic
1003120561 6:3315983-3316005 TCCCAAACAGCAGGGCTCAGCGG + Intronic
1003916689 6:10793432-10793454 TGGCAACAAGCTGGGCAGAATGG + Intronic
1005041503 6:21604457-21604479 TGGCAAACAGGAGAGATAAAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006154388 6:32006437-32006459 TGCCCAGCAGCAGGGCTGAGCGG - Intergenic
1006160701 6:32039173-32039195 TGCCCAGCAGCAGGGCTGAGCGG - Exonic
1006373512 6:33659393-33659415 GGGCCCAGAGCAGGGCTGAAGGG - Intronic
1006433841 6:34015622-34015644 TGGCAGAGTGCAGGGCTGACGGG + Intergenic
1006730216 6:36230785-36230807 TGGCACACAGCAGGCCTGCCAGG - Exonic
1007078962 6:39085354-39085376 CGGGAAACAGCAGGGAGGAAGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012910859 6:105116317-105116339 TGGAAGACAGCAGGGTTCAAAGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014252471 6:119128735-119128757 TGGCAGATAGCAGGCCTGGAAGG + Intronic
1014859620 6:126448957-126448979 TGGCAAACAGCAGAGCTTCTTGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018143989 6:160865795-160865817 TGAAAAACAGCATGGCTTAAGGG + Intergenic
1019613332 7:1947810-1947832 GGGCCAGCAGGAGGGCTGAAGGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022315573 7:29241790-29241812 TGGCAAACTAGAGGGCTGAGTGG + Intronic
1027382583 7:77626462-77626484 TGGCTAACAGGAGGGCTGCGGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029680292 7:102103651-102103673 TGTCAAACTGCTGGGCTCAAGGG + Intronic
1029705705 7:102274694-102274716 AGGCCACCGGCAGGGCTGAAGGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030730191 7:112978731-112978753 TGCCAAACATCAGGGCTTCAAGG + Intergenic
1030772842 7:113496273-113496295 TGCCAAACATCAGGGCTTCAAGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031075725 7:117210413-117210435 TAGCAAACACCAGGGTTCAATGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1038372418 8:27007393-27007415 TTGCAAAGAGCAGGGCTCACTGG + Intergenic
1038964042 8:32551460-32551482 TAGCACACAGCGGGGCTGAGTGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044206231 8:89494523-89494545 CTGCAGACAGCAAGGCTGAAAGG + Intergenic
1044820011 8:96149803-96149825 TGGCAAACTCCAGAGCGGAAAGG + Intronic
1045357372 8:101401809-101401831 TGGCACTCAGCAGGTGTGAAAGG + Intergenic
1045521803 8:102909944-102909966 TGGCATTCTGCAGAGCTGAAAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048843803 8:138587807-138587829 TGGCTAACAGCTTGGGTGAATGG + Intergenic
1048971478 8:139647339-139647361 TGGCAAACAGCAGGTCCTCATGG - Intronic
1049636076 8:143690153-143690175 AGGCAGCCAGCAGGGCAGAAGGG - Intronic
1050931321 9:11330734-11330756 TGCCAAAGAGCTGGGGTGAAAGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053167467 9:35854497-35854519 AGGGAATCAGCAGGGCTGATGGG + Exonic
1053586005 9:39459583-39459605 TGTTCAACAGCAGGTCTGAACGG + Intergenic
1054580304 9:66905639-66905661 TGTTCAACAGCAGGTCTGAACGG - Intronic
1056577106 9:87864088-87864110 CACCAAACAGCAGGGATGAAGGG + Intergenic
1057369977 9:94462653-94462675 TGGCAAACAGCAGGTCTGAGTGG - Intergenic
1057900169 9:98942554-98942576 TGGCAGGCAGCATGGCTGAGTGG + Intergenic
1059115982 9:111600122-111600144 GGGCAAGCGGCAGGGCTGACGGG - Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186528216 X:10269085-10269107 TGGCTAGGAGCAGAGCTGAAGGG - Intergenic
1187701510 X:21968168-21968190 TGGCCAGCAGCAGTGCTGCAGGG + Intronic
1188230359 X:27655504-27655526 GGGCCAACAGCTGAGCTGAAGGG + Intronic
1189204055 X:39222521-39222543 TGGCAGACATTAGGGGTGAAAGG - Intergenic
1189428452 X:40924800-40924822 TGGTACACAGCAGTGCTGAGGGG - Intergenic
1190836056 X:54101697-54101719 TGGCAAAGAACTTGGCTGAATGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193497652 X:82234126-82234148 TAACAAAAAGCAGAGCTGAACGG - Intergenic
1194849633 X:98855357-98855379 TAGGAAACATCAGGACTGAAGGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195731909 X:107977092-107977114 TGGCAAACTGCGCAGCTGAAAGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199409817 X:147508500-147508522 TGTCAAACAGCAAGGCTTATCGG + Intergenic
1199846830 X:151697659-151697681 AGGCAAAAAGGAGGGCTCAATGG + Intronic
1200732011 Y:6752748-6752770 TGGCATACAGCAGGGGAAAATGG + Intergenic
1201742374 Y:17337614-17337636 TGGGGGTCAGCAGGGCTGAAGGG + Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic