ID: 952653919

View in Genome Browser
Species Human (GRCh38)
Location 3:35760811-35760833
Sequence TGTCCCACCCACATTAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952653915_952653919 29 Left 952653915 3:35760759-35760781 CCATGGGAAAAAGTGCATTTTCA 0: 1
1: 0
2: 3
3: 26
4: 340
Right 952653919 3:35760811-35760833 TGTCCCACCCACATTAGGATTGG 0: 1
1: 0
2: 1
3: 17
4: 192
952653917_952653919 1 Left 952653917 3:35760787-35760809 CCTAAATCATTGTTTCTTGAGAG 0: 1
1: 0
2: 4
3: 23
4: 250
Right 952653919 3:35760811-35760833 TGTCCCACCCACATTAGGATTGG 0: 1
1: 0
2: 1
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952653919 Original CRISPR TGTCCCACCCACATTAGGAT TGG Intronic
905172729 1:36118644-36118666 TGTCCCACCCACATCTGGTCTGG - Intronic
905467772 1:38168597-38168619 AGGCCCACCCACATTGGGAAGGG - Intergenic
905766345 1:40604758-40604780 AGGCCCACCCACATTATGAAAGG - Intergenic
906045670 1:42829092-42829114 TGTCCCACCCACTTTCCTATAGG - Intronic
907617600 1:55940265-55940287 AGGCCCACCCACATTAAGAAGGG + Intergenic
908842301 1:68292498-68292520 TGTTCCTCCCAGATGAGGATTGG + Intergenic
909459296 1:75892063-75892085 GGACCCACCCACATTAGGTAGGG - Intronic
909464703 1:75960361-75960383 GGGTCCACCCACATTAGGGTGGG + Intergenic
911378106 1:97076443-97076465 AGGCCCACCCACATTATGAAGGG + Intergenic
912555825 1:110515363-110515385 GGGCCCACACACATTAGGAAGGG - Intergenic
912968489 1:114258271-114258293 AGGCCCACCCACATTAGGGAGGG + Intergenic
913519767 1:119633575-119633597 AGGCCCACCCACATTATGGTGGG + Intronic
915655518 1:157356464-157356486 GGGCCCACCCACATTAGGGAGGG + Intergenic
918843000 1:189568581-189568603 TGTCCCAACACCATTAGGTTTGG - Intergenic
919389126 1:196959798-196959820 TGACCCACCCACATTATCAAGGG - Intergenic
921078154 1:211716362-211716384 TGTGGCCACCACATTAGGATGGG - Intergenic
921940548 1:220834338-220834360 AGGCCCACCCATATTAGGAAAGG - Intergenic
922024898 1:221741162-221741184 TCTCTCACCCACCTTTGGATGGG + Intronic
922489429 1:226003931-226003953 TGGTCCACCCACATTAGGGGAGG + Intergenic
923186439 1:231578005-231578027 AGGTCCACCCACATTAGGAAGGG - Intronic
923257822 1:232236320-232236342 GGACCCACCCACATTAGGGAGGG - Intergenic
1063051368 10:2452925-2452947 TGGCCCACCCACATTGGGGAGGG + Intergenic
1063679212 10:8171206-8171228 AGGCCCACCCACATTAGGGAGGG + Intergenic
1067199447 10:44154586-44154608 AGGCCCACCCACATTATGGTAGG - Intergenic
1070787263 10:79169143-79169165 TGTCCCACCAACCTGAGGGTGGG - Intronic
1071967390 10:90866222-90866244 AGGCCCACCCACATTAGGGAGGG - Intergenic
1072035458 10:91559156-91559178 AGGCCCACCCACATTAGGGAGGG - Intergenic
1072957119 10:99897035-99897057 TGTGTCACCCGCATTAGGATGGG - Intronic
1078401006 11:11027132-11027154 TGCCCGACCCTGATTAGGATGGG + Intergenic
1079794887 11:24788871-24788893 AGGCCCACCCACATTATGAAGGG + Intronic
1082082180 11:48020774-48020796 TGCCCCTCCCACGTTTGGATGGG + Intronic
1084440770 11:69171694-69171716 AGGCCCACCCACATTAGGGAGGG + Intergenic
1085672206 11:78477695-78477717 TAGCCCACCCACATTATGAAGGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1091103272 11:132895672-132895694 GTTCCCACCCACAATAGTATAGG + Intronic
1092217797 12:6694960-6694982 TGCCCCACCCTCAGTGGGATGGG + Exonic
1093758880 12:22882719-22882741 AGGCCCACCCACATTATGAAGGG - Intergenic
1096153575 12:49329773-49329795 AGTCCCACCCTCATGAGGAATGG - Intronic
1096565720 12:52476748-52476770 AGGCCTACCCACATTAGGAAGGG - Intergenic
1096662995 12:53140804-53140826 TGTTCAACCTACATTAGGAATGG + Intergenic
1097923451 12:65102478-65102500 AGACCCACCCACATTAGGGAGGG + Intronic
1098200103 12:68045253-68045275 TGTCTCACCAACATGATGATGGG - Intergenic
1098732275 12:74052118-74052140 AGACCCACCCACATTAGGGAGGG + Intergenic
1098807443 12:75037430-75037452 TTGCCCACCCACATTAAGAAAGG - Intergenic
1102210940 12:111126622-111126644 AGGCCCACTCACATTAGGAAGGG + Intronic
1102681456 12:114693134-114693156 TGTCCCCCCCACATCAGAAGTGG - Intergenic
1104261962 12:127192926-127192948 TGTCCCACCCGCATGAGGGTAGG - Intergenic
1105208803 13:18245599-18245621 TGGCCCACCCATATTATGGTGGG + Intergenic
1105542174 13:21325375-21325397 AGGCCCACCCACATTATGAAGGG - Intergenic
1106010251 13:25813827-25813849 AGGCCCACCCACATTAGGGAGGG - Intronic
1106491022 13:30222154-30222176 AGGCCCACCCACATTAGGAAGGG - Intronic
1107246878 13:38307472-38307494 TATGGCACCCACATTAGAATGGG + Intergenic
1107596590 13:41969318-41969340 AGGCCCACCCACATTAGGAAGGG + Intergenic
1111066185 13:83095532-83095554 AGGCCCACCCACATTAGGGAGGG - Intergenic
1113636867 13:111925434-111925456 TGTGCCCCCCACAGCAGGATTGG + Intergenic
1115779541 14:36754195-36754217 AGACCCACCCACATTATGAAGGG - Intronic
1115823765 14:37241283-37241305 TGGCCCACCTACATTAGGGAGGG + Intronic
1118903323 14:70004425-70004447 GGACCCACCCACATTATGAAGGG - Intronic
1120715679 14:87838499-87838521 AGGCCCACCCACATTAGGGAGGG + Intronic
1120906207 14:89623468-89623490 AGGCCCACCCACATTAGGGTGGG + Intergenic
1121170062 14:91846156-91846178 TGTCACACCTGCATTAGGATTGG + Intronic
1122246655 14:100407924-100407946 TCTCCCACTCCCATCAGGATAGG - Intronic
1122562715 14:102628197-102628219 AGTCCCACCCACATTAAGGAGGG + Intronic
1125164085 15:36682389-36682411 AGGCCCACCCACATTAGGGAGGG + Intronic
1125863160 15:43017115-43017137 TGTAGCAACCACATCAGGATCGG - Exonic
1128521184 15:68375893-68375915 AGGCCCACCCACATTAGGAAGGG - Intronic
1130611614 15:85366494-85366516 TCTACCACCCACATTACGGTAGG - Intergenic
1130682800 15:86011068-86011090 TGGCCCACCCACATTATGGAGGG - Intergenic
1131463252 15:92634798-92634820 GGGCCCACCCACATTAGGGAGGG - Intronic
1134747272 16:16597980-16598002 GGGCCCACCCACATTAGGGAGGG + Intergenic
1134998203 16:18755679-18755701 GGGCCCACCCACATTAGGGAGGG - Intergenic
1138153015 16:54676858-54676880 TGTGCCTCCCACAATAAGATAGG + Intergenic
1138301662 16:55935379-55935401 AGGGCCACCCACATTAGGAAGGG + Intronic
1138800807 16:60026537-60026559 ATTCCCATCCACATTAGGAAGGG + Intergenic
1144129339 17:12230686-12230708 TGTCCCAGCCTCATTAAGAAAGG - Intergenic
1146452260 17:32983908-32983930 TGGCCCACCCACATTAGGGAGGG + Intronic
1147879334 17:43643815-43643837 TGTCTTACCCATATTAGAATTGG + Intronic
1151121073 17:71793691-71793713 AGGCCCACCCACATGAGGAAGGG - Intergenic
1153309473 18:3663912-3663934 AGACCCACCCACCTTAGGAAGGG - Intronic
1153405381 18:4732893-4732915 AGGCCCACCCACATTAGGGAGGG + Intergenic
1155198232 18:23495081-23495103 AGGCCCACTCACATTAGGAAGGG + Intergenic
1156321688 18:36031372-36031394 TGTCCAGGCCCCATTAGGATAGG - Intronic
1156576596 18:38324077-38324099 AGGCCCACCCACATTATGAAGGG - Intergenic
1158821500 18:61164700-61164722 AGGCCCACCCACATTATGAAGGG + Intergenic
1159648736 18:70952373-70952395 TGTCCCACCCACAAAAGGAGGGG - Intergenic
1162203441 19:9037963-9037985 TGTCACACCCATATTAGGCTTGG - Intergenic
1162252937 19:9461654-9461676 TCTCCCACCCACATTACAGTTGG - Intergenic
1163338046 19:16686491-16686513 TGTCCCAGCCACATAAGGCTGGG - Intronic
1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG + Intronic
926625584 2:15086905-15086927 AGGCCCACCCACATTAGGAAGGG - Intergenic
929529284 2:42736967-42736989 TGGCTCAGCCACAGTAGGATGGG - Intronic
931139447 2:59440673-59440695 TGGCCCACCCACAGCAGCATGGG - Intergenic
931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG + Intergenic
933523413 2:83404404-83404426 AGGCCCACCCACATTATGAAGGG + Intergenic
935831715 2:107007413-107007435 AGTCCCACCCACATTATGGGGGG - Intergenic
937898824 2:127000401-127000423 AGGCCCACCCACATTAGGGAAGG + Intergenic
941299636 2:163785337-163785359 AGGCCCACCCACATTAGGGAGGG - Intergenic
943718452 2:191177824-191177846 AGGCCCACCCACATTATGAAAGG - Intergenic
943814138 2:192230045-192230067 TGTCCTACTCACATTAGTACTGG - Intergenic
947376011 2:229495614-229495636 AGGCCCACCCACGTTAGGAAGGG + Intronic
948778634 2:240303402-240303424 TATCCCACCCACAGTGGGAGAGG - Intergenic
1171289971 20:23977315-23977337 TGGCCCACCCATATTATGGTGGG + Intergenic
1172954260 20:38744425-38744447 AGGCCCACTCACATTAGGAAGGG + Intergenic
1177581077 21:23022124-23022146 GTCCCCACCCACATTAGGGTGGG - Intergenic
1178504116 21:33149389-33149411 TGGCCCAGCCTCATTAGGAAGGG + Intergenic
1180767457 22:18353718-18353740 TGGCCCACCCATATTATGGTGGG - Intergenic
1180778849 22:18508664-18508686 TGGCCCACCCATATTATGGTGGG + Intergenic
1180811571 22:18765985-18766007 TGGCCCACCCATATTATGGTGGG + Intergenic
1181197724 22:21200233-21200255 TGGCCCACCCATATTATGGTGGG + Intergenic
1181395851 22:22621053-22621075 TGGCCCACCCATATTATGGTGGG - Intergenic
1181647527 22:24241515-24241537 TGGCCCACCCATATTATGGTGGG + Intronic
1181703977 22:24636668-24636690 TGGCCCACCCATATTATGGTGGG - Intergenic
1182089105 22:27581922-27581944 TGTCTCTCCCACATCTGGATTGG - Intergenic
1183097279 22:35560500-35560522 TGGCCCACGCACATCAGGAATGG - Intergenic
1203229079 22_KI270731v1_random:94602-94624 TGGCCCACCCATATTATGGTGGG - Intergenic
949820118 3:8106945-8106967 AGGCCCAACCACATTAGGAAGGG - Intergenic
951169425 3:19522507-19522529 AGGCCCACCCACATTAGGGAGGG + Intronic
952402350 3:32974819-32974841 AGACCCACCCACATTAGGGTGGG + Intergenic
952653919 3:35760811-35760833 TGTCCCACCCACATTAGGATTGG + Intronic
953157570 3:40388459-40388481 TGTGCCAGCAACATTTGGATGGG - Intronic
955703767 3:61707594-61707616 GATCCCACCCACATTAGGGAGGG + Intronic
957348991 3:78998824-78998846 TGTCCCACCCTATTTTGGATAGG + Intronic
958100380 3:89001021-89001043 AGTCCCATCCACAGTAGGTTTGG + Intergenic
960457163 3:117886423-117886445 AGTCCGACACACATTAAGATTGG + Intergenic
963032738 3:140995055-140995077 TGGCCCACCCACATTAGGAAGGG + Intergenic
966055672 3:175685856-175685878 AGGCCCACCTACATTAGGAAAGG + Intronic
966977550 3:185098784-185098806 GGGCCCACCCACATTATGAAGGG - Intronic
968203011 3:196772213-196772235 CGTCCCTCCCACATAAGGCTAGG - Intronic
970543382 4:17101815-17101837 AGGCCCACCCACATTAAGAAGGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971225776 4:24750334-24750356 AGGCCCACCCACATTAAGAAGGG + Intergenic
971431888 4:26577004-26577026 AGTCCCACCCACATTATGGAGGG - Intronic
972499059 4:39660958-39660980 AGACCCACCCACATTAGGGAAGG + Intergenic
972589910 4:40475697-40475719 TGTCGCACCCAGATCAAGATTGG - Intronic
972922312 4:43959307-43959329 AGGCCCACCCACATTAGGAAGGG - Intergenic
975957214 4:79855991-79856013 TGTCCCTCCCACAGTAAAATGGG - Intergenic
978665705 4:111178494-111178516 TAGCCCACCCACATTGGGAAAGG - Intergenic
980897757 4:138876053-138876075 TTTCCCACACACTTTAGGAGAGG + Intergenic
984157217 4:176207427-176207449 TATCCCACCCACCTTGTGATTGG + Intergenic
985888552 5:2698829-2698851 TGTTCCACCCACTCTAGGAAGGG - Intergenic
986186370 5:5444952-5444974 TGTCCCACCCACACAATGAAGGG - Intronic
986519987 5:8605029-8605051 AGGCCCACCCACATTATGAAAGG - Intergenic
986646748 5:9924213-9924235 AGACCCACCTACATTAGGGTGGG - Intergenic
991281328 5:64917594-64917616 AGGGCCACCCACATTAGGAAGGG - Intronic
992332300 5:75729792-75729814 AGGCCCACCCACATTGGGAAGGG + Intergenic
993580326 5:89653015-89653037 TGGCTCACCCACAGTAGGATAGG + Intergenic
995405381 5:111788845-111788867 AGGCCCACCCACATTAGGGAAGG - Intronic
999524095 5:152383659-152383681 AGGCCCACTCACATTAGGAAGGG - Intergenic
1001925284 5:175631525-175631547 TCTCCCACCCACCTTGGGGTAGG + Intergenic
1002983547 6:2165498-2165520 GGGCCCACCCACATTAGGGAGGG + Intronic
1003409855 6:5852481-5852503 AGGCCCACCCACATTATGAAGGG + Intergenic
1003469638 6:6417145-6417167 TGTGCCACCCACATTCAGCTTGG - Intergenic
1005698028 6:28369647-28369669 GGGCCCACCCACATTAGGGAGGG + Intergenic
1007813153 6:44500486-44500508 CCTCCCACCCACCTTAGGAAAGG + Intergenic
1009449398 6:63783943-63783965 AGGCCCACCCACATTAGGGAGGG - Intronic
1009581182 6:65535750-65535772 ATGCCCACCCACATTAGGAAAGG + Intronic
1010673597 6:78716256-78716278 TGGCCCAGCCACATTAGGGATGG - Intergenic
1011074012 6:83418486-83418508 AGGCCCACCCACATTAGGGAGGG + Intronic
1011082361 6:83503556-83503578 AGGCCCACCCACATCAGGAAGGG + Intergenic
1012404928 6:98885475-98885497 AGGCCCACCCACATTAGGTAGGG - Intronic
1012483044 6:99689527-99689549 TGTCTCAGCCGCAGTAGGATTGG + Intergenic
1012934698 6:105354584-105354606 AGTCCCACCCACATTATGGAGGG - Intronic
1013479001 6:110536265-110536287 TTTCCCACCTACATAAAGATAGG - Intergenic
1013685178 6:112572676-112572698 GGGCCCACTCACATTAGGAAGGG - Intergenic
1013861744 6:114644104-114644126 AGGCCCAACCACATTAGGAAGGG - Intergenic
1014347220 6:120287648-120287670 AGGCCCACCCACATTATGAAGGG + Intergenic
1014894531 6:126885870-126885892 TGTCCCACGCAAACTGGGATGGG + Intergenic
1015927155 6:138322108-138322130 AGGCCCACCCACATTAGGGAGGG - Intronic
1016431556 6:143990941-143990963 TGTTCCAACCACATGAGAATAGG + Intronic
1016795323 6:148111100-148111122 AGGCCCACCCACATTAGAGTAGG - Intergenic
1017443070 6:154482391-154482413 TGGCCCACCCACTTTGGGACTGG - Intronic
1017516449 6:155160373-155160395 AGGCCCACCCACATTAGGGAAGG + Intronic
1017583314 6:155891513-155891535 TGTGCCACTGACATAAGGATAGG + Intergenic
1019151294 6:170007685-170007707 TGTGCCATGCAGATTAGGATAGG + Intergenic
1021198566 7:17699437-17699459 TCCCCCTCCCAAATTAGGATGGG - Intergenic
1021807311 7:24370109-24370131 AGGCCCACCCACATTAGGGAGGG - Intergenic
1021928440 7:25555628-25555650 TGTGCAGCCCACATTAAGATTGG + Intergenic
1024715159 7:52071252-52071274 AGCCCCACCCACATTGGGAAGGG - Intergenic
1024863571 7:53876385-53876407 AGACCCACCCACATTAAGACGGG + Intergenic
1028388708 7:90290472-90290494 AGGCCCACCCACATTAGTAAGGG + Intronic
1028671254 7:93402719-93402741 AGGCCCACCCACATTAGGGATGG + Intergenic
1029336066 7:99900318-99900340 AGGCCCACCCACATTATGAAGGG + Intronic
1030495347 7:110291772-110291794 TCTCCCACCCACATGTGTATGGG - Intergenic
1033635345 7:143206867-143206889 TGTGCCTCCCACATTAGTATAGG - Intergenic
1036634437 8:10539265-10539287 AGGCCCACCCACATTATGATGGG + Intronic
1037654819 8:20873834-20873856 CGTCCCACCCACATTAACTTTGG + Intergenic
1038135933 8:24785764-24785786 TATCTCACACTCATTAGGATGGG + Intergenic
1038344325 8:26718342-26718364 AGACCCACCCACATTAGCAAAGG + Intergenic
1038522632 8:28246431-28246453 AGGCCCACCCACATTATGACAGG - Intergenic
1038669085 8:29567240-29567262 TGACCCACTCACAGTAGGAAGGG + Intergenic
1038707271 8:29906300-29906322 AGGCCCACCCACATTATGAGGGG + Intergenic
1038829480 8:31041375-31041397 AGGCCCACCCACATTAGGGAGGG + Intronic
1039292745 8:36113942-36113964 AGTCCCACCCACATTATGGAGGG + Intergenic
1041113826 8:54514387-54514409 AGGCCCACCCACATTAGGGAAGG - Intergenic
1041613653 8:59881200-59881222 TGTTCCACCCACTTGAGGGTGGG - Intergenic
1045051737 8:98333711-98333733 TGACCCACCCACATTAAGGAGGG - Intergenic
1048601013 8:135918842-135918864 AGGCCCACCCACATTGGGAAGGG + Intergenic
1049555703 8:143280595-143280617 AGGCCCACCCACATTATGAAGGG + Intergenic
1053490325 9:38495428-38495450 GGGCCCACCCACATCAGGAAGGG + Intergenic
1055353881 9:75417750-75417772 TGTTACACCAACACTAGGATTGG + Intergenic
1057458301 9:95234963-95234985 GGGCCCACCCGTATTAGGATGGG + Intronic
1060137227 9:121169301-121169323 TGTTCCACACACTTCAGGATTGG + Intronic
1060877313 9:127092777-127092799 TCTTCCACCTACATTAGGAGCGG - Intronic
1061903868 9:133686567-133686589 TGTGCCAGGCACATTGGGATAGG - Intronic
1186068538 X:5792379-5792401 TTTCCCACCCACATTGGAAAAGG - Intergenic
1187137115 X:16558699-16558721 AGGCCCACCCACATTAGGGAGGG + Intergenic
1189372093 X:40436685-40436707 AGGCCCACCCACATTAGGGAGGG - Intergenic
1194417839 X:93635612-93635634 AGTCCTACCCACATTAAGAAGGG + Intergenic
1196315236 X:114214177-114214199 TATCCAAACCACATCAGGATAGG + Intergenic
1199269489 X:145865892-145865914 AGGACCACCCACATTAGGAAGGG - Intergenic
1199723821 X:150563033-150563055 TGTCCTGCCCCCATTAGGCTGGG + Intergenic