ID: 952655929

View in Genome Browser
Species Human (GRCh38)
Location 3:35785452-35785474
Sequence CTAGAGGAATGGATCATGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952655929 Original CRISPR CTAGAGGAATGGATCATGCA CGG (reversed) Intronic
900535791 1:3176598-3176620 ATAGATGAATGGATGATGGATGG - Intronic
903623245 1:24713348-24713370 CTAAAAGAATGAATCATGGATGG - Intergenic
904548983 1:31299305-31299327 CTAGAGAAATGTAGGATGCAAGG + Intronic
904581246 1:31545770-31545792 AAAGACGAATGGATGATGCATGG - Intergenic
904812706 1:33173837-33173859 CTACAGGCATGCATCATGCCTGG + Intronic
911603996 1:99880424-99880446 CTGGAGAAATGGCTCATGTAAGG - Intronic
915057848 1:153152276-153152298 CTAGAAGAATGGGGGATGCAGGG - Intergenic
916994035 1:170276492-170276514 ATAGACCAATGGATCTTGCAGGG - Intergenic
918437398 1:184530161-184530183 CTAGAAGAATAGAGCATGTATGG - Intronic
918511003 1:185314651-185314673 CTAGAGGAATGAGTAAAGCATGG + Intronic
921354191 1:214270235-214270257 TTAGATGAATGGATAATACAAGG - Intergenic
923839041 1:237647476-237647498 CTAGATGAAAGGATAATGCCTGG - Intronic
924815592 1:247438982-247439004 ATAGAGGGATGGATGATGGATGG - Intronic
1066455772 10:35570102-35570124 GGAGAGGAATGGATTAGGCAGGG - Exonic
1068390722 10:56392779-56392801 CTAGAAAAATGAATCATGGAGGG + Intergenic
1070084048 10:73217799-73217821 CAAGAGGTAGGAATCATGCATGG + Intronic
1070229957 10:74555151-74555173 CTACAGGCATGGGCCATGCAGGG - Intronic
1071967247 10:90864286-90864308 CTAAAAGAATGGATCAGGCTGGG - Intergenic
1073136963 10:101225527-101225549 GCAGAGGTATGGATCTTGCAAGG - Intergenic
1073743522 10:106439576-106439598 CTATAGGAAGGGATCATGTCAGG + Intergenic
1075918308 10:126188843-126188865 ATAGATGAATGGATTATGGATGG - Intronic
1076092518 10:127700107-127700129 GCAGAGGAATTGATCATACAGGG + Intergenic
1079419155 11:20270032-20270054 CTTGAGGACTGGATCAAACACGG - Intergenic
1081237840 11:40667436-40667458 CAAGAGGAGTGGATTATGCAAGG - Intronic
1083735966 11:64681467-64681489 CTGGAGGAAGGGATCAAGGAAGG + Intronic
1084368334 11:68718271-68718293 CCAGAGAAACGGACCATGCATGG + Intronic
1084576525 11:69992160-69992182 GTAGATGAATGGATGATGGATGG + Intergenic
1085504760 11:77051639-77051661 CTGTGGGAATGGAGCATGCAGGG + Intergenic
1087260373 11:96004147-96004169 CTAGAGGAATGGAAAATTCATGG - Intronic
1097632307 12:62079161-62079183 TTAGAGGAAAGCATCCTGCAAGG - Intronic
1100231319 12:92611143-92611165 CATGAGGAATGGATGAGGCATGG - Intergenic
1106065667 13:26346005-26346027 CTAGAGGAATGGATTATGTCTGG - Intronic
1106374007 13:29166170-29166192 CTAGAGAAATAGATATTGCAAGG - Intronic
1110139794 13:72114462-72114484 CAAGAGGAGTGGATTATACAAGG + Intergenic
1112235382 13:97631221-97631243 CTAGAGGAATTGTGCCTGCAGGG + Intergenic
1116954182 14:50907032-50907054 CTAGAGGAATGGATACTGGAGGG - Intronic
1118916533 14:70112169-70112191 CGAGAAGAATGGATGGTGCAAGG + Intronic
1118945191 14:70378954-70378976 CCAGAGGAAAGGAGCAGGCAAGG - Intronic
1119926551 14:78500003-78500025 CTAAAGGAAGGGATTATGTAAGG + Intronic
1121809907 14:96875850-96875872 CTAAAGGAATGGATGAGGGATGG - Intronic
1122022048 14:98846216-98846238 CAAGGGGAAAGGATCAAGCAAGG - Intergenic
1128518942 15:68362720-68362742 ATAGATGAATGGATAATGGATGG + Intronic
1131651722 15:94406818-94406840 CTAGTGGAAGGGATCATGGAAGG + Intronic
1134620495 16:15685391-15685413 CTACAGGCACGCATCATGCACGG + Intronic
1138304489 16:55961906-55961928 CTAGAGCTATGGATAATCCATGG + Intergenic
1139198179 16:64945431-64945453 CTAGAGAAAAGGATCATCCATGG + Exonic
1139452657 16:67043043-67043065 CTTGAAGAATGGATCATAAAAGG - Intronic
1141779250 16:86148159-86148181 CTAGAGCCATGGATAACGCAGGG - Intergenic
1151198274 17:72447290-72447312 CAAGAGGGATGGATTATGAATGG - Intergenic
1151198382 17:72448422-72448444 CAAGAGGGATGGATTATGAATGG + Intergenic
1153883139 18:9438096-9438118 CCAGTGGAATGGCTCATCCAGGG + Intergenic
1155422100 18:25666811-25666833 CTAGATGATTGGATCAGGAAAGG + Intergenic
1157450274 18:47781111-47781133 CCAGAGGAAGGGATTATCCAAGG + Intergenic
1159804274 18:72937255-72937277 ATAGATGAATGGCTCATACATGG + Intergenic
1159806431 18:72963115-72963137 CTACAGGAATCCCTCATGCAAGG + Intergenic
1159854837 18:73573366-73573388 ATAAAGGGATGGATCATGAAAGG + Intergenic
1160709561 19:544802-544824 GTAGAGGGATGGATGATGGATGG - Intronic
1162161317 19:8720098-8720120 TTAGAGGGATGGATGATGGATGG - Intergenic
1164396339 19:27867010-27867032 CTAGAGAATTGGAAAATGCATGG - Intergenic
1164875662 19:31685008-31685030 CTAGAGGGATGGAAGATGAAAGG - Intergenic
1166065739 19:40357730-40357752 CTAGAGGAATAAATCAGACACGG + Intronic
925472592 2:4178899-4178921 CTACAAGAATGGATAATGCAGGG + Intergenic
925888270 2:8412034-8412056 CCAGAGGAATGGTTCTTTCAGGG - Intergenic
927249007 2:20981517-20981539 ATAGATGGATGGATGATGCATGG + Intergenic
927434218 2:23053352-23053374 CTAAAGGAATGGATTTTTCACGG - Intergenic
928078378 2:28286295-28286317 CTAGAGGATTGTACCATGCTGGG + Intronic
934739478 2:96709376-96709398 CTTGAGAAATGGCTGATGCAGGG - Intronic
937831955 2:126434029-126434051 CTAGAGGACTCGTTCAAGCATGG + Intergenic
938599568 2:132822892-132822914 TTAGAGAAATGCAACATGCAGGG + Intronic
938716784 2:134028299-134028321 CTACAGGAAGGGATCTTGCAGGG + Intergenic
943483048 2:188446000-188446022 CTAGAGGAATGGCTGAAGAATGG - Intronic
943497802 2:188646121-188646143 CTAAAGGAATGAATAATCCAGGG - Intergenic
946916193 2:224524698-224524720 TTGGAGGAAGGTATCATGCAGGG + Intronic
946952365 2:224891060-224891082 CTAGAAGGATGGATGATGGATGG + Intronic
947149451 2:227099812-227099834 CTAGAGAAATGAAGCATCCATGG + Intronic
1168843047 20:921978-922000 CTAGCCTCATGGATCATGCAGGG + Intergenic
1169664867 20:8022460-8022482 CAAGAGGAAAGGATCACACAAGG - Intergenic
1169983603 20:11416126-11416148 CTAGAGGGAGGGAGCATGGAGGG - Intergenic
1170764630 20:19279567-19279589 ATACAGGAAGGGATCATGAAAGG - Intronic
1173379651 20:42528424-42528446 TTAGATGAATGGATAATGAATGG - Intronic
1173726143 20:45299338-45299360 CTAGAAGAGAAGATCATGCAGGG + Intronic
1174515729 20:51091062-51091084 CTAGGGCAAGTGATCATGCAAGG + Intergenic
1174617532 20:51847387-51847409 CAAGAGCAATGGTTCATGCAAGG + Intergenic
1175817205 20:61889426-61889448 ATAGATGAATGGATGATGCATGG + Intronic
1178404446 21:32312696-32312718 CTAGAGGACTAGATCTTTCAAGG - Exonic
1179081414 21:38174038-38174060 CAAGAGGAAGGGATTATTCAAGG - Intronic
1180696347 22:17753876-17753898 CTGGGGGAATGGCACATGCAGGG - Intronic
1180931268 22:19593474-19593496 CTGGAGGCTTGGCTCATGCAAGG + Intergenic
1182923055 22:34097774-34097796 CTAGAGGAAGGGATCATGCGAGG + Intergenic
1185108628 22:48888224-48888246 GTAGATCAATGGATCATGAATGG - Intergenic
950168937 3:10822914-10822936 CTAAAGGAATAGATCGTCCATGG - Intronic
950549399 3:13657019-13657041 CTATAGAAATGAATCAGGCATGG - Intergenic
950691241 3:14659852-14659874 CTGGAGAAAGGGATCCTGCAGGG + Intronic
950938460 3:16867602-16867624 CTAGAGGAATGGTGGATGCATGG + Intronic
952655929 3:35785452-35785474 CTAGAGGAATGGATCATGCACGG - Intronic
953172363 3:40518854-40518876 CAAGAGGAAGGGATTATGGAGGG - Intergenic
954886634 3:53881021-53881043 CTAGAGGGAAGGATCTGGCAAGG + Intronic
954901136 3:54021085-54021107 CCAGAGGAATGTTTCATGAAAGG + Intergenic
955412822 3:58666983-58667005 CTACAGGAAGGGAACAGGCATGG - Intergenic
956143048 3:66164961-66164983 CTAGAGGCATGGATCATTGGGGG - Intronic
962752739 3:138445768-138445790 CTAAAGGCATGGATGATGCTCGG - Intronic
962983281 3:140509669-140509691 CTGGAGGAATGGGACATGCCAGG - Intronic
963377476 3:144486986-144487008 CTAGAAGAATGAATTAAGCAAGG - Intergenic
965102438 3:164317389-164317411 ATAGAGAAATGGATTTTGCATGG + Intergenic
966570048 3:181431087-181431109 CTAGAAGATTGCATAATGCATGG + Intergenic
967714539 3:192747341-192747363 CAAGAGGAATGGATTCTCCAGGG - Intronic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
974472024 4:62331046-62331068 CAAGTGGAGTGGATCATGTAAGG - Intergenic
975618619 4:76273206-76273228 CTGGAGGAATGGAACAAGGATGG + Intronic
976204825 4:82614794-82614816 CTATAGAAATGCATCCTGCAAGG - Intergenic
978079220 4:104571526-104571548 CCTGAGGAATGCATCTTGCATGG - Intergenic
978358149 4:107899751-107899773 CTAGAAGAATGTATAATACAGGG - Intronic
979890094 4:126081563-126081585 ATAAAGGAATGCATCATGCCCGG - Intergenic
981100782 4:140826943-140826965 CTGGAGGTCTGGATCTTGCAGGG + Intergenic
983673221 4:170262115-170262137 CTAAAGGAATGGCTCATGTGAGG - Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
986358278 5:6950026-6950048 CTACAGGCAAGGATCATTCAGGG - Intergenic
986624472 5:9710423-9710445 CTAAAGTAATGGTTCATGCAGGG - Intronic
986758379 5:10858081-10858103 CTGGATGAATGGATCGTGCCAGG - Intergenic
987881267 5:23749381-23749403 CAGGGGGAATGTATCATGCAAGG - Intergenic
989306986 5:39969496-39969518 CTTTTGGAATTGATCATGCACGG - Intergenic
991203854 5:64026345-64026367 CCAGATGAATGATTCATGCAAGG + Intergenic
992522944 5:77574807-77574829 ATACAGGAATGTATTATGCATGG - Intronic
995927990 5:117398903-117398925 CTAAAGGCATGGATGAAGCAGGG - Intergenic
996389440 5:122943787-122943809 CAAGAGGAGGGGATCATACAAGG + Intronic
998142536 5:139708373-139708395 CCAGTGGAAAGGATCAAGCAGGG - Intergenic
998379608 5:141714754-141714776 CTAGAGGAATGCATGACTCAGGG + Intergenic
1000431695 5:161160189-161160211 ATGGAGGAATGGATGATGGATGG - Intergenic
1000652039 5:163830260-163830282 CTGGAGGCAGGGATCAGGCAGGG - Intergenic
1000781056 5:165481777-165481799 CTGCATGAATAGATCATGCATGG - Intergenic
1002591491 5:180293649-180293671 GTAGAGGAACGGATCCAGCATGG + Intergenic
1005075274 6:21900964-21900986 GCACAAGAATGGATCATGCAGGG + Intergenic
1007263014 6:40576944-40576966 GTGCAGGAACGGATCATGCATGG - Intronic
1007325308 6:41054955-41054977 CCAGAGCAATGGATCCTGAAGGG + Intronic
1008483860 6:52014486-52014508 ATAGATGGATGGATCATGGATGG + Intronic
1008483912 6:52014775-52014797 ATAGATGGATGGATCATGGATGG + Intronic
1017734391 6:157347950-157347972 GTAGATGAAAGGAGCATGCATGG + Intergenic
1018088073 6:160321975-160321997 CTAGAGGGATGGAGCCTGTAGGG - Intergenic
1022384668 7:29890082-29890104 TTACAGGCATGGATCATGCCTGG - Intronic
1024090600 7:45936854-45936876 GGAGAGGAATGGGTCATGTAGGG + Intergenic
1025086439 7:56027339-56027361 AAAGAGGAATGCATAATGCATGG + Intronic
1029418740 7:100460781-100460803 CTACAGGCATGCATCATGCCTGG + Intronic
1031359740 7:120834911-120834933 CAAGGGGAATGGCTCATGGAGGG - Intronic
1032582737 7:133118191-133118213 CTAGTGGAAGGGATTAGGCAAGG - Intergenic
1033435790 7:141332520-141332542 CTAGAGGAATGGACGATGAAGGG - Intronic
1034237973 7:149587381-149587403 CCATGGGAATGGATCATACAGGG + Intergenic
1035670125 8:1410494-1410516 CTAGAGGAAGGCTTCCTGCAGGG + Intergenic
1039412278 8:37365031-37365053 CTTCAGGAATGGACCATGGAAGG - Intergenic
1041791983 8:61706668-61706690 CTAGAGAAATGGATGAGGAAAGG + Intronic
1041882650 8:62769968-62769990 CAAGAGGAGAGGATTATGCAAGG - Intronic
1042323558 8:67504341-67504363 CAAGAGGAAGGAATTATGCAGGG - Intronic
1043398916 8:79864825-79864847 CTAGAGTAATGGAGCTGGCAGGG - Intergenic
1044305293 8:90633079-90633101 CTAGGGGAAGGGATCACACAAGG - Intronic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1044747078 8:95381166-95381188 TTTGAGGCATGGATAATGCATGG + Intergenic
1047673493 8:127174028-127174050 CTAGAGGAATGGCAGATGCAAGG - Intergenic
1047806626 8:128367726-128367748 ATAGAGGAAGGGTTCATGGAGGG + Intergenic
1050051013 9:1601565-1601587 ATAGAGGAATGGAGAAGGCAGGG + Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1053108294 9:35433015-35433037 CTATAGGAATGTTTCATTCAGGG + Intergenic
1058024106 9:100121340-100121362 CAAGAGGAAGGGATCATACGGGG + Intronic
1058134105 9:101288185-101288207 CTAGAGGACTGGTTCCTGGATGG - Intronic
1060821362 9:126663283-126663305 CTACAGGCATGCATCATGCCTGG - Intronic
1061225863 9:129280720-129280742 CTAGAGCAGTGGCTCAGGCAGGG - Intergenic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061431116 9:130531918-130531940 CTGGAGGAAAGGATGATGCCAGG + Intergenic
1062447965 9:136603650-136603672 CTAGGGGAATGGAGAATGCAGGG - Intergenic
1186581671 X:10826232-10826254 CGAAAGGAGTGGATGATGCATGG - Intronic
1188633798 X:32402501-32402523 CTAGATGAATGGTTGAGGCATGG - Intronic
1190934154 X:54979705-54979727 CAAGAGGTATGGATCATTAAGGG - Intronic
1192204801 X:69088738-69088760 CTATAGGAATGGAAAATACAGGG + Intergenic
1196395820 X:115261019-115261041 CTACAGGCATGCACCATGCATGG - Intergenic
1198829964 X:140739874-140739896 CAAGAGAAAAGGATCATGGAGGG + Intergenic
1201921948 Y:19243524-19243546 AAAGAGGAATGAGTCATGCAGGG - Intergenic