ID: 952656478

View in Genome Browser
Species Human (GRCh38)
Location 3:35792509-35792531
Sequence CCTGATAAGAAGACATTGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952656478_952656482 5 Left 952656478 3:35792509-35792531 CCCAACAATGTCTTCTTATCAGG 0: 1
1: 0
2: 3
3: 13
4: 161
Right 952656482 3:35792537-35792559 ATAAGCAGCTTGGAAAATTGTGG 0: 1
1: 0
2: 0
3: 20
4: 219
952656478_952656483 6 Left 952656478 3:35792509-35792531 CCCAACAATGTCTTCTTATCAGG 0: 1
1: 0
2: 3
3: 13
4: 161
Right 952656483 3:35792538-35792560 TAAGCAGCTTGGAAAATTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 216
952656478_952656481 -5 Left 952656478 3:35792509-35792531 CCCAACAATGTCTTCTTATCAGG 0: 1
1: 0
2: 3
3: 13
4: 161
Right 952656481 3:35792527-35792549 TCAGGTGCTCATAAGCAGCTTGG 0: 1
1: 0
2: 0
3: 28
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952656478 Original CRISPR CCTGATAAGAAGACATTGTT GGG (reversed) Exonic
902699973 1:18165401-18165423 CCTTATAAGAAGAAATAATTTGG - Intronic
904819318 1:33230768-33230790 CTTGAGAAGCAGCCATTGTTTGG - Intergenic
905953621 1:41974064-41974086 CCTCTTAAGAAGAGATTCTTAGG + Intronic
906284387 1:44577187-44577209 CCTGATAGGAAGACAGTCCTAGG - Intronic
908878142 1:68700935-68700957 CCTTATAAGAAGAGAAAGTTTGG - Intergenic
911347252 1:96711904-96711926 CCTATTAAGAATAGATTGTTGGG + Intergenic
913039545 1:115009146-115009168 CCTGATATGCAGCCATTGATTGG - Intergenic
913443559 1:118925497-118925519 ACTGGAAAAAAGACATTGTTTGG + Intronic
915138320 1:153749677-153749699 TCTGGTAAGAAGAGACTGTTAGG - Intronic
917309100 1:173659188-173659210 TCTTAGAAGAAGACATCGTTGGG - Exonic
918111897 1:181462252-181462274 CCTGATAAGGAGAAATTCCTAGG + Intronic
918308629 1:183269497-183269519 CCTGAGAAGAGAACACTGTTTGG - Intronic
918640339 1:186833065-186833087 CATGTAAAGAAGATATTGTTAGG + Intronic
919013477 1:191996401-191996423 CCTGAGAAGAAGCCAAAGTTTGG - Intergenic
919457991 1:197842757-197842779 CCTGATTAGGAGTCATTGTGAGG - Intergenic
922423685 1:225475483-225475505 GCTGATGAGAAGACACTGCTGGG - Intergenic
922464531 1:225838133-225838155 ACTGATCAGAAGATATTGCTGGG - Intronic
923261631 1:232273466-232273488 CCTCAGAAGATGACCTTGTTTGG + Intergenic
923540821 1:234886811-234886833 TTTGCTAAGAAGACAGTGTTTGG - Intergenic
1064006099 10:11700302-11700324 CCTGGTAAGAAGACAAGATTTGG + Intergenic
1065450286 10:25849385-25849407 CCTGGTAAGATGACAGTGTGTGG + Intergenic
1067819196 10:49511947-49511969 CCTCATAAAAAGTCATTATTTGG - Intronic
1070127614 10:73634733-73634755 CCTGAAAAGAAGACAAAGTGAGG + Exonic
1071418718 10:85466502-85466524 CCTGATAAAAAGACATAGATTGG + Intergenic
1072243426 10:93519244-93519266 CCTACTTAGGAGACATTGTTAGG - Intronic
1072455406 10:95571111-95571133 CCTGATTAGAATAGATGGTTTGG - Intergenic
1072920016 10:99569014-99569036 CCCGAAAGGAAGACATTCTTTGG + Intergenic
1075337765 10:121620906-121620928 TTTGATAAGAAGACATTGTGTGG + Intergenic
1075535939 10:123272240-123272262 CCTGATAAGAGCAAATTGATTGG + Intergenic
1078674956 11:13401995-13402017 CCTGAGAAGAAGACATTCAAGGG - Intronic
1082032068 11:47612111-47612133 CCTGAAAAGAAGCTATTTTTTGG + Intergenic
1082941468 11:58709736-58709758 CCTGAACATAAGACAGTGTTGGG - Exonic
1085210713 11:74775091-74775113 CTTGAAAAGAAAACATTCTTGGG - Intronic
1086018372 11:82195135-82195157 CCTGAAGAGAAGAAATTCTTGGG - Intergenic
1087337881 11:96867007-96867029 CTTGATAAGAAAACCTTATTAGG + Intergenic
1089342861 11:117771390-117771412 CCTAACAAGAAGGCTTTGTTGGG - Intronic
1090600885 11:128369949-128369971 ACTGATAGGACCACATTGTTGGG - Intergenic
1093943691 12:25083866-25083888 CCTGATTAGAACATATCGTTAGG - Intronic
1097854733 12:64450867-64450889 CCTTATAAGAAAACACTGTGTGG + Exonic
1098400711 12:70072617-70072639 ACTGAAAAAAAGACATTCTTTGG - Intergenic
1101345227 12:103880118-103880140 CATGATAAGAAAACATGTTTGGG + Intergenic
1101930575 12:109010453-109010475 CTTGAAAAGAGGCCATTGTTTGG - Intronic
1103867714 12:124066311-124066333 CCTGATCAGCAGAAATTGTGAGG - Intronic
1104070160 12:125337656-125337678 CTAGATAACAAGACATTATTGGG - Intronic
1107412264 13:40168876-40168898 CCTTATAAGAAGAGATTGCCAGG - Intergenic
1108318625 13:49263992-49264014 CCTTATAAGAAAACACTGTGTGG - Intronic
1109497242 13:63189085-63189107 CCTGATAATAGGATAATGTTTGG + Intergenic
1116501375 14:45627206-45627228 ACACATAAGAAGAGATTGTTAGG + Intergenic
1117013002 14:51489868-51489890 TCTTACAAGAAGTCATTGTTGGG - Intronic
1117432988 14:55688108-55688130 TCTCATCAGAAGACATTCTTAGG - Intronic
1120604049 14:86549869-86549891 CCTGAGAAGCAGCCATAGTTTGG - Intergenic
1125066564 15:35493691-35493713 CTTGATAGCAACACATTGTTTGG - Intronic
1125788980 15:42348591-42348613 CCTGATAAGAAATCACTGGTTGG - Intronic
1125990800 15:44105827-44105849 CTTAATAAGAAGAAATTGTGTGG - Intronic
1127308622 15:57731488-57731510 CATGAAAAGAAGACATATTTAGG - Intronic
1127789359 15:62385172-62385194 CATCAAAAGAAGACATTTTTTGG - Intergenic
1130920672 15:88341884-88341906 ACTGATAAGGAGAAATTGCTTGG - Intergenic
1133208048 16:4245913-4245935 CCTGACAAGAAGAGTTTCTTGGG + Intergenic
1135298584 16:21304248-21304270 CATGATATAAACACATTGTTTGG - Intergenic
1138790137 16:59893905-59893927 ACTAATAAGAAAACATTGGTTGG - Intergenic
1138983184 16:62295578-62295600 CCAAATGAGAAGACATTGGTTGG - Intergenic
1142158216 16:88542635-88542657 CCTGGTGGGAAGACATTGTCAGG + Intergenic
1147244572 17:39111583-39111605 GCTGATAAGAAGGCAGGGTTTGG - Intronic
1151261003 17:72915846-72915868 TCTGCTAAGTAGACATTTTTAGG + Intronic
1153501576 18:5755253-5755275 CCTGAGAATATGACATTATTTGG - Intergenic
1153692826 18:7610426-7610448 CCCTTTAAGAAGACATTGTTTGG + Intronic
1153812181 18:8761904-8761926 CCTTATATGAAGATATGGTTTGG - Intronic
1154300735 18:13189760-13189782 TCTAATAATTAGACATTGTTGGG - Intergenic
1156052703 18:32956612-32956634 CCTGGAAAGAAGATTTTGTTAGG - Intronic
1156393575 18:36675839-36675861 GCTGCTAAGAAGACATTATTTGG + Intronic
1157227314 18:45879087-45879109 GCTGATGTGAAGACATTCTTGGG - Exonic
1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG + Intronic
1159380704 18:67654440-67654462 CCCTATAAGAAGAGATTGTATGG + Intergenic
1160111246 18:76033850-76033872 CCTAAGAAGAAGACCTTTTTTGG + Intergenic
1165118063 19:33541115-33541137 CCAGATAAGATCACATTGTGAGG + Intergenic
925805956 2:7648349-7648371 CATGATAATAAAATATTGTTTGG + Intergenic
926065899 2:9839660-9839682 ATTCATCAGAAGACATTGTTAGG - Intergenic
926747241 2:16168926-16168948 CCAGATAAGAAGACAATGACAGG + Intergenic
926775035 2:16413629-16413651 CCTCATTAGCAGACAATGTTTGG + Intergenic
926894467 2:17669589-17669611 GCTGGTAAGAAGACATTTTAAGG + Intronic
927018202 2:18990285-18990307 CCTCATATGAAGACATTCTGGGG + Intergenic
927276158 2:21264244-21264266 CCTGATTAGAAAACCTTTTTGGG + Intergenic
929964613 2:46524917-46524939 CCTGCTAAGAAGCCTTTGATGGG - Intronic
930082189 2:47460072-47460094 CTAGATAAGAATACCTTGTTGGG + Intronic
933453113 2:82482821-82482843 CCTGATATGAACACACTGTAGGG - Intergenic
933859356 2:86449510-86449532 CCTGATAAGTAGGGGTTGTTTGG + Intronic
935830879 2:106999755-106999777 ATTGATAAAAAGACATTATTCGG - Intergenic
938373080 2:130786090-130786112 CCTGAAAAGAAGACAATGTTTGG - Intergenic
938677394 2:133652127-133652149 CCTGATAAGTATACAAAGTTTGG + Intergenic
939150130 2:138462663-138462685 TCTCAAAAGAAGACATTTTTGGG - Intergenic
941247569 2:163119281-163119303 CCTGAACAGAATACATTGTTGGG + Intergenic
941350269 2:164424064-164424086 CAAGATATGAAGACTTTGTTTGG - Intergenic
943399936 2:187395367-187395389 AATGAAAAGAAGAAATTGTTGGG - Intronic
944014951 2:195024882-195024904 CCAGATAAGAACACATTTTTAGG - Intergenic
945364768 2:208938556-208938578 CCTTATAAGAAGAAAATATTAGG - Intergenic
947493826 2:230618593-230618615 TCTTATAAGAAGAGATTTTTTGG + Intergenic
948206524 2:236165439-236165461 ACTGAAAAGCAGACATTGTTAGG - Exonic
1169066624 20:2697654-2697676 CCTGGTAGGAAGACATTGGTAGG - Intronic
1169722765 20:8697148-8697170 CCTGATGAGAATTTATTGTTGGG - Intronic
1173529026 20:43754379-43754401 CGTGAGAGGAAGATATTGTTTGG - Intergenic
1174598384 20:51703245-51703267 CTTTATAAGAAGATATTATTGGG - Intronic
1176095493 20:63342162-63342184 CTTGAAAAGAAGACATCTTTCGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184127273 22:42496475-42496497 CCAGATAAGATGACATTCTGAGG + Intergenic
951278283 3:20716149-20716171 TCTCAAAAGAAGACATTTTTGGG + Intergenic
951826109 3:26870938-26870960 CATGAGAAGAAAAGATTGTTGGG + Intergenic
952396238 3:32922873-32922895 CCTGATTAGGAGGAATTGTTGGG + Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
954839694 3:53499501-53499523 CCTTATCAGAAGGAATTGTTAGG + Intronic
955470091 3:59277804-59277826 CCTGATAAGAATTTATTGTTTGG - Intergenic
956629362 3:71300021-71300043 CCAGATAAGTAGAGATTCTTGGG - Intronic
956688483 3:71854609-71854631 CCAGATAAGGAGAGACTGTTAGG - Intergenic
958134447 3:89470215-89470237 CCTGAAAAGTAGCCATTATTAGG - Intronic
962297700 3:134206960-134206982 TCTGACATGAAGACATCGTTGGG - Intronic
964405485 3:156344121-156344143 CCTGATAAAAAGACATTGTGGGG - Intronic
966545702 3:181144845-181144867 CCTGAAAAATAGACATTGTATGG - Intergenic
970654105 4:18212613-18212635 CCTGGTTAAAAGCCATTGTTGGG + Intergenic
971538883 4:27790283-27790305 CATGATAAGAACTCTTTGTTAGG - Intergenic
974213348 4:58811782-58811804 CCTATTAAAAAGACATAGTTTGG - Intergenic
975300945 4:72790747-72790769 ACTAATAAGATGACATTTTTAGG + Intergenic
975728801 4:77318071-77318093 GCTGAGAAGTAGACATTGTGAGG + Intronic
975883122 4:78934950-78934972 TCTCATAAGAACACATCGTTTGG + Intronic
977201700 4:94123868-94123890 ACTCACAACAAGACATTGTTTGG + Intergenic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
978283510 4:107045783-107045805 CCTGGTGAGGAGAAATTGTTTGG + Intronic
979204201 4:118015637-118015659 CCTGATTAGATTACATTTTTGGG - Intergenic
982453973 4:155585878-155585900 CCTGAAAAAAAGCCATTCTTAGG - Intergenic
984178447 4:176450310-176450332 CCAAATCAAAAGACATTGTTTGG - Intergenic
987238362 5:15967006-15967028 ACTAATAAGAAGACATTTATAGG - Intergenic
992775945 5:80089473-80089495 CCAGATAAGCAGACATGTTTAGG - Intergenic
998657992 5:144204307-144204329 CCTGATAAGAATATAGTGCTTGG - Intronic
1001910917 5:175517076-175517098 ACTGAACAGAAGACATAGTTGGG + Intronic
1003975360 6:11338084-11338106 CCAGATAAGATGACATTCTGAGG - Intronic
1005439558 6:25851367-25851389 CCTCATCAAAAGGCATTGTTAGG - Intronic
1005632789 6:27724389-27724411 CCTGTGAAGAAGTCACTGTTAGG + Intergenic
1006548901 6:34804080-34804102 CCTGAAAGGAAGACAGTGTGGGG - Intronic
1008935691 6:56989643-56989665 CATGATAAAAAGACATCATTTGG - Intronic
1012632964 6:101496310-101496332 CCTGATAATAAAACATTGTTAGG + Intronic
1013678421 6:112493518-112493540 CCTGTTAATGAGACATTTTTAGG + Intergenic
1015026186 6:128535574-128535596 GATCATACGAAGACATTGTTAGG - Intergenic
1018546654 6:164944472-164944494 AGTGATAAAAAGAAATTGTTTGG + Intergenic
1020961919 7:14815815-14815837 CGTGATAAGAACACATTGCTGGG + Intronic
1023678125 7:42652002-42652024 CCTGAGAGAAAGACATTGTCAGG + Intergenic
1024700914 7:51903150-51903172 CCTGATAACCACACATTGCTCGG + Intergenic
1026568637 7:71510641-71510663 CCTGGTAAGGAGACACTGTCAGG - Intronic
1028365732 7:90028695-90028717 CATTATACAAAGACATTGTTAGG + Intergenic
1028805085 7:95016883-95016905 CCAGATAAGAATACATTGAAAGG - Intronic
1029173731 7:98648732-98648754 CCTGAAAGGATGAGATTGTTAGG + Intergenic
1030272219 7:107682189-107682211 CCTGACAAGCATACATTTTTGGG - Intronic
1030934434 7:115567701-115567723 ACTGAAAAGAAGACATGATTTGG + Intergenic
1033211458 7:139463062-139463084 CCTTTTAAGAAGAAATTGCTGGG - Intronic
1033235287 7:139633477-139633499 CTTGGTAATAAGACATTTTTGGG - Intronic
1037959120 8:23083357-23083379 CCTGACAACATGAAATTGTTGGG + Intergenic
1037966217 8:23135717-23135739 CCTGACAACATGAAATTGTTGGG - Exonic
1039558117 8:38491447-38491469 CCTTATAAGAAGAGGATGTTAGG - Intergenic
1042424830 8:68635378-68635400 ACTGATATGAAGAAATTGTGTGG - Intronic
1043249951 8:78059416-78059438 AGTGATTATAAGACATTGTTTGG - Intergenic
1045718367 8:105075785-105075807 TATAATAAGAAGACATTGATTGG - Intronic
1046154748 8:110273311-110273333 CCTGTTAAGAAGACATATTAAGG + Intergenic
1048522349 8:135168554-135168576 CTTGATAAGAAGGCATGTTTGGG - Intergenic
1049922594 9:379264-379286 CTTGATATGCAGACATTTTTAGG + Intronic
1050140413 9:2511202-2511224 CCACCTAAGAAGAAATTGTTGGG - Intergenic
1050846087 9:10221138-10221160 CTTTATAGGAAGACATTGATAGG - Intronic
1051027492 9:12630669-12630691 CCTGCTAACAATTCATTGTTGGG - Intergenic
1051478210 9:17531960-17531982 CCTGACCAGCAGACACTGTTGGG - Intergenic
1054942864 9:70763000-70763022 ACTGATAAGAAGACATCTTCTGG - Intronic
1058297901 9:103332113-103332135 CCTGTTAACAAAACATTTTTTGG - Intergenic
1059949456 9:119447091-119447113 TCTGATGTGAAGACATTCTTGGG - Intergenic
1062017830 9:134300481-134300503 CCTGCTAAAGAGACAGTGTTAGG - Intergenic
1185847013 X:3447191-3447213 CCTTATAAGAAGACACTCTGGGG + Intergenic
1186264929 X:7822125-7822147 TCTGACAAGAAGAGAGTGTTAGG + Intergenic
1187536169 X:20143233-20143255 CCTTACAAGAAGATATTATTAGG + Intergenic
1189133478 X:38524974-38524996 CCTGAAAAAAAGAAATTGCTAGG - Intronic
1189143729 X:38634894-38634916 CCTGATAAGAAGCCATGGTCAGG + Intronic
1196201470 X:112890758-112890780 CCTGAGATGAAGTCATTGTGAGG - Intergenic
1197370471 X:125620774-125620796 CCTGGTTAGAAACCATTGTTGGG + Intergenic
1199242920 X:145569108-145569130 CCTAGTAAGAATACATTGTTTGG - Intergenic
1199424012 X:147680400-147680422 CCTGGTAATAAGAGATTGTTTGG + Intergenic