ID: 952658199

View in Genome Browser
Species Human (GRCh38)
Location 3:35813169-35813191
Sequence AAGAGTAATCAGGGCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952658199_952658203 15 Left 952658199 3:35813169-35813191 CCATCAGGGCCCTGATTACTCTT No data
Right 952658203 3:35813207-35813229 ATCCACTAGTGAAGCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952658199 Original CRISPR AAGAGTAATCAGGGCCCTGA TGG (reversed) Intergenic
No off target data available for this crispr