ID: 952662349

View in Genome Browser
Species Human (GRCh38)
Location 3:35866874-35866896
Sequence AGATGATCACAGTGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952662346_952662349 13 Left 952662346 3:35866838-35866860 CCAATTTGAAGAGTCCAAATAGA No data
Right 952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG No data
952662347_952662349 -1 Left 952662347 3:35866852-35866874 CCAAATAGATAACACAAAACAAA No data
Right 952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952662349 Original CRISPR AGATGATCACAGTGTCAGCT GGG Intergenic
No off target data available for this crispr