ID: 952662650

View in Genome Browser
Species Human (GRCh38)
Location 3:35870264-35870286
Sequence AGGTGATGCAGCTGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952662650_952662651 -7 Left 952662650 3:35870264-35870286 CCATCTGTTCAGCTGCATCACCT No data
Right 952662651 3:35870280-35870302 ATCACCTCTAGAACATTGCCTGG No data
952662650_952662655 24 Left 952662650 3:35870264-35870286 CCATCTGTTCAGCTGCATCACCT No data
Right 952662655 3:35870311-35870333 TAGAGGATCGCTATATCCCAAGG No data
952662650_952662653 7 Left 952662650 3:35870264-35870286 CCATCTGTTCAGCTGCATCACCT No data
Right 952662653 3:35870294-35870316 ATTGCCTGGCGAGATCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952662650 Original CRISPR AGGTGATGCAGCTGAACAGA TGG (reversed) Intergenic
No off target data available for this crispr